Mutagenetix > Incidental Mutation

Incidental Mutation 'R6368:Cr2'

512772

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

044518-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R6368 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195168472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 229 (S229P)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043104
AA Change: S209P

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: S209P

Domain	Start	End	E-Value	Type
CCP	2	58	5.04e-7	SMART
CCP	63	120	3.58e-12	SMART
CCP	125	191	1.2e-13	SMART
CCP	197	252	2.73e-17	SMART
CCP	256	311	1.01e-15	SMART
Blast:CCP	316	347	2e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000082321

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194149

Predicted Effect

probably benign
Transcript: ENSMUST00000195120

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195722

Predicted Effect

probably damaging
Transcript: ENSMUST00000210219
AA Change: S229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 55,990,132	E272D	possibly damaging	Het
Abi2	A	G	1: 60,453,651	T158A	possibly damaging	Het
Acacb	T	C	5: 114,216,823	S1221P	probably damaging	Het
Agbl1	A	G	7: 76,419,830	D370G	probably benign	Het
Apeh	A	G	9: 108,087,243	I487T	probably damaging	Het
Arid1b	C	A	17: 5,332,533	N1297K	possibly damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atp7b	A	C	8: 22,020,755		probably null	Het
Bsn	C	T	9: 108,111,314		probably benign	Het
Caps2	C	T	10: 112,194,968	Q268*	probably null	Het
Cnfn	C	T	7: 25,367,961		probably null	Het
Cubn	T	C	2: 13,430,995	Y1050C	probably damaging	Het
Cubn	T	C	2: 13,476,123	E307G	probably damaging	Het
Cyb5r3	A	C	15: 83,160,124	Y182D	possibly damaging	Het
Dclre1a	A	T	19: 56,546,791	H120Q	probably benign	Het
Ddx6	T	C	9: 44,635,776	I457T	probably damaging	Het
E2f1	A	T	2: 154,564,476	H93Q	possibly damaging	Het
Fam186a	T	C	15: 99,943,317	K1682R	possibly damaging	Het
Farsb	A	G	1: 78,466,965		probably null	Het
Flii	A	T	11: 60,721,136	L347Q	probably damaging	Het
Galntl6	T	G	8: 58,911,441	T12P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm21680	T	C	5: 25,969,036	N190S	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,125	S364G	probably benign	Het
Kdm2a	A	G	19: 4,350,317	I234T	probably damaging	Het
Kdm5b	T	C	1: 134,599,207	C356R	probably damaging	Het
Kel	A	T	6: 41,688,851	C174*	probably null	Het
Krt16	T	A	11: 100,246,676	D401V	probably damaging	Het
Ltb4r1	A	C	14: 55,767,743	I168L	probably benign	Het
Luzp1	T	A	4: 136,541,780	M438K	probably benign	Het
Mtf1	C	T	4: 124,824,352	T281M	probably damaging	Het
Myo9a	T	A	9: 59,924,948	S2587T	probably benign	Het
Olfr1311	A	T	2: 112,021,551	I101N	probably damaging	Het
Olfr1377	T	A	11: 50,984,786	F28L	probably benign	Het
Olfr532	G	T	7: 140,419,667	Y35*	probably null	Het
Olfr860	T	C	9: 19,846,409	D70G	probably damaging	Het
Pcm1	T	A	8: 41,293,544	F1221Y	probably benign	Het
Pnldc1	A	T	17: 12,905,864	N90K	probably damaging	Het
Prickle2	A	T	6: 92,420,237	L169Q	probably damaging	Het
Ralgps2	A	T	1: 156,884,574	L147I	probably damaging	Het
Rfx3	A	T	19: 27,768,609	L674Q	possibly damaging	Het
Rpl3	C	A	15: 80,082,544	L14F	probably damaging	Het
Rrbp1	C	T	2: 143,989,555	G231R	probably damaging	Het
Sema3d	C	T	5: 12,571,013	L529F	probably damaging	Het
Slain1	A	T	14: 103,656,955	T193S	probably benign	Het
Slc2a6	G	T	2: 27,024,587	Q256K	possibly damaging	Het
Slk	A	G	19: 47,620,183	E525G	possibly damaging	Het
Spsb4	G	T	9: 96,944,645	Q252K	probably benign	Het
Taf1b	A	G	12: 24,558,257	T552A	possibly damaging	Het
Tmprss15	T	C	16: 79,006,057		probably null	Het
Tph2	T	C	10: 115,179,326	H177R	probably damaging	Het
Ttll1	A	G	15: 83,489,617	S332P	probably damaging	Het
Twf2	T	G	9: 106,212,833	N128K	probably benign	Het
Vegfc	T	A	8: 54,181,230	C315S	probably damaging	Het
Vmn2r111	T	A	17: 22,571,908	K136N	probably benign	Het
Wnk2	T	C	13: 49,061,338	E496G	probably damaging	Het
Zfp148	C	A	16: 33,497,198	Q705K	probably damaging	Het
Zw10	C	T	9: 49,073,235	A539V	probably damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- ATAAATACGCAACGTTTCCGG -3'
(R):5'- CCAATGGAGACTTCTACAGCAG -3'

Sequencing Primer
(F):5'- AACGTTTCCGGCCCAACTTAC -3'
(R):5'- GCAGCAGAGACAGCTTTTTC -3'

Posted On

2018-04-27