Mutagenetix > Incidental Mutation

Incidental Mutation 'R6368:Cubn'

512773

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

044518-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6368 (G1)

Quality Score

224.009

Status

Not validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13430995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1050 (Y1050C)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: Y1050C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: Y1050C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195447

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 55,990,132 (GRCm38)	E272D	possibly damaging	Het
Abi2	A	G	1: 60,453,651 (GRCm38)	T158A	possibly damaging	Het
Acacb	T	C	5: 114,216,823 (GRCm38)	S1221P	probably damaging	Het
Agbl1	A	G	7: 76,419,830 (GRCm38)	D370G	probably benign	Het
Apeh	A	G	9: 108,087,243 (GRCm38)	I487T	probably damaging	Het
Arid1b	C	A	17: 5,332,533 (GRCm38)	N1297K	possibly damaging	Het
Ascc3	G	A	10: 50,699,985 (GRCm38)	G779S	probably damaging	Het
Atp7b	A	C	8: 22,020,755 (GRCm38)		probably null	Het
Bsn	C	T	9: 108,111,314 (GRCm38)		probably benign	Het
Caps2	C	T	10: 112,194,968 (GRCm38)	Q268*	probably null	Het
Cnfn	C	T	7: 25,367,961 (GRCm38)		probably null	Het
Cr2	A	G	1: 195,168,472 (GRCm38)	S229P	probably damaging	Het
Cyb5r3	A	C	15: 83,160,124 (GRCm38)	Y182D	possibly damaging	Het
Dclre1a	A	T	19: 56,546,791 (GRCm38)	H120Q	probably benign	Het
Ddx6	T	C	9: 44,635,776 (GRCm38)	I457T	probably damaging	Het
E2f1	A	T	2: 154,564,476 (GRCm38)	H93Q	possibly damaging	Het
Fam186a	T	C	15: 99,943,317 (GRCm38)	K1682R	possibly damaging	Het
Farsb	A	G	1: 78,466,965 (GRCm38)		probably null	Het
Flii	A	T	11: 60,721,136 (GRCm38)	L347Q	probably damaging	Het
Galntl6	T	G	8: 58,911,441 (GRCm38)	T12P	probably damaging	Het
Gm11595	G	A	11: 99,772,555 (GRCm38)	R100C	unknown	Het
Gm21680	T	C	5: 25,969,036 (GRCm38)	N190S	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,125 (GRCm38)	S364G	probably benign	Het
Kdm2a	A	G	19: 4,350,317 (GRCm38)	I234T	probably damaging	Het
Kdm5b	T	C	1: 134,599,207 (GRCm38)	C356R	probably damaging	Het
Kel	A	T	6: 41,688,851 (GRCm38)	C174*	probably null	Het
Krt16	T	A	11: 100,246,676 (GRCm38)	D401V	probably damaging	Het
Ltb4r1	A	C	14: 55,767,743 (GRCm38)	I168L	probably benign	Het
Luzp1	T	A	4: 136,541,780 (GRCm38)	M438K	probably benign	Het
Mtf1	C	T	4: 124,824,352 (GRCm38)	T281M	probably damaging	Het
Myo9a	T	A	9: 59,924,948 (GRCm38)	S2587T	probably benign	Het
Olfr1311	A	T	2: 112,021,551 (GRCm38)	I101N	probably damaging	Het
Olfr1377	T	A	11: 50,984,786 (GRCm38)	F28L	probably benign	Het
Olfr532	G	T	7: 140,419,667 (GRCm38)	Y35*	probably null	Het
Olfr860	T	C	9: 19,846,409 (GRCm38)	D70G	probably damaging	Het
Pcm1	T	A	8: 41,293,544 (GRCm38)	F1221Y	probably benign	Het
Pnldc1	A	T	17: 12,905,864 (GRCm38)	N90K	probably damaging	Het
Prickle2	A	T	6: 92,420,237 (GRCm38)	L169Q	probably damaging	Het
Ralgps2	A	T	1: 156,884,574 (GRCm38)	L147I	probably damaging	Het
Rfx3	A	T	19: 27,768,609 (GRCm38)	L674Q	possibly damaging	Het
Rpl3	C	A	15: 80,082,544 (GRCm38)	L14F	probably damaging	Het
Rrbp1	C	T	2: 143,989,555 (GRCm38)	G231R	probably damaging	Het
Sema3d	C	T	5: 12,571,013 (GRCm38)	L529F	probably damaging	Het
Slain1	A	T	14: 103,656,955 (GRCm38)	T193S	probably benign	Het
Slc2a6	G	T	2: 27,024,587 (GRCm38)	Q256K	possibly damaging	Het
Slk	A	G	19: 47,620,183 (GRCm38)	E525G	possibly damaging	Het
Spsb4	G	T	9: 96,944,645 (GRCm38)	Q252K	probably benign	Het
Taf1b	A	G	12: 24,558,257 (GRCm38)	T552A	possibly damaging	Het
Tmprss15	T	C	16: 79,006,057 (GRCm38)		probably null	Het
Tph2	T	C	10: 115,179,326 (GRCm38)	H177R	probably damaging	Het
Ttll1	A	G	15: 83,489,617 (GRCm38)	S332P	probably damaging	Het
Twf2	T	G	9: 106,212,833 (GRCm38)	N128K	probably benign	Het
Vegfc	T	A	8: 54,181,230 (GRCm38)	C315S	probably damaging	Het
Vmn2r111	T	A	17: 22,571,908 (GRCm38)	K136N	probably benign	Het
Wnk2	T	C	13: 49,061,338 (GRCm38)	E496G	probably damaging	Het
Zfp148	C	A	16: 33,497,198 (GRCm38)	Q705K	probably damaging	Het
Zw10	C	T	9: 49,073,235 (GRCm38)	A539V	probably damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,491,820 (GRCm38)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,456,697 (GRCm38)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,381,849 (GRCm38)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,427,056 (GRCm38)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,278,418 (GRCm38)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,282,919 (GRCm38)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,294,230 (GRCm38)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,467,710 (GRCm38)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,381,927 (GRCm38)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,456,623 (GRCm38)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,278,408 (GRCm38)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,478,093 (GRCm38)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,310,566 (GRCm38)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,465,908 (GRCm38)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,284,041 (GRCm38)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,350,862 (GRCm38)	splice site	probably benign
IGL01534:Cubn	APN	2	13,465,933 (GRCm38)	nonsense	probably null
IGL01584:Cubn	APN	2	13,308,661 (GRCm38)	splice site	probably benign
IGL01595:Cubn	APN	2	13,325,216 (GRCm38)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,306,274 (GRCm38)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,489,936 (GRCm38)	nonsense	probably null
IGL01972:Cubn	APN	2	13,446,072 (GRCm38)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,287,594 (GRCm38)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,339,846 (GRCm38)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,381,837 (GRCm38)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,427,834 (GRCm38)	splice site	probably null
IGL02491:Cubn	APN	2	13,321,228 (GRCm38)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,325,226 (GRCm38)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,446,032 (GRCm38)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,445,040 (GRCm38)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,294,370 (GRCm38)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,318,312 (GRCm38)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,287,094 (GRCm38)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,355,689 (GRCm38)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,426,967 (GRCm38)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,360,329 (GRCm38)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,478,057 (GRCm38)	splice site	probably null
mellow	UTSW	2	13,478,078 (GRCm38)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,468,852 (GRCm38)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,491,750 (GRCm38)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,306,432 (GRCm38)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,356,709 (GRCm38)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,476,035 (GRCm38)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,440,514 (GRCm38)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,424,694 (GRCm38)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,310,507 (GRCm38)	splice site	probably benign
R0364:Cubn	UTSW	2	13,310,507 (GRCm38)	splice site	probably benign
R0383:Cubn	UTSW	2	13,430,959 (GRCm38)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,469,764 (GRCm38)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,469,763 (GRCm38)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,444,267 (GRCm38)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,428,680 (GRCm38)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,360,252 (GRCm38)	splice site	probably null
R0735:Cubn	UTSW	2	13,491,689 (GRCm38)	splice site	probably benign
R0780:Cubn	UTSW	2	13,456,613 (GRCm38)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,362,328 (GRCm38)	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13,336,242 (GRCm38)	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13,445,000 (GRCm38)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,287,568 (GRCm38)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,360,319 (GRCm38)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,325,288 (GRCm38)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,325,288 (GRCm38)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,476,120 (GRCm38)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,427,105 (GRCm38)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,287,661 (GRCm38)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,427,967 (GRCm38)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,469,789 (GRCm38)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,489,317 (GRCm38)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,308,561 (GRCm38)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,323,002 (GRCm38)	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13,310,526 (GRCm38)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,278,538 (GRCm38)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,340,017 (GRCm38)	splice site	probably null
R2021:Cubn	UTSW	2	13,308,549 (GRCm38)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,336,167 (GRCm38)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,444,378 (GRCm38)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,336,167 (GRCm38)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,318,242 (GRCm38)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,404,080 (GRCm38)	nonsense	probably null
R2369:Cubn	UTSW	2	13,491,217 (GRCm38)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,476,150 (GRCm38)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,318,272 (GRCm38)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,278,356 (GRCm38)	splice site	probably null
R2850:Cubn	UTSW	2	13,322,953 (GRCm38)	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13,430,834 (GRCm38)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,358,139 (GRCm38)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,362,347 (GRCm38)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,362,347 (GRCm38)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,358,162 (GRCm38)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,333,508 (GRCm38)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,350,943 (GRCm38)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,350,943 (GRCm38)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,350,943 (GRCm38)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,331,585 (GRCm38)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,427,914 (GRCm38)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,360,353 (GRCm38)	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13,294,325 (GRCm38)	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13,283,008 (GRCm38)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,283,008 (GRCm38)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,286,980 (GRCm38)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,326,677 (GRCm38)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,313,999 (GRCm38)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,428,563 (GRCm38)	intron	probably benign
R4405:Cubn	UTSW	2	13,466,030 (GRCm38)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,428,749 (GRCm38)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,313,979 (GRCm38)	splice site	probably null
R4770:Cubn	UTSW	2	13,314,767 (GRCm38)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,351,058 (GRCm38)	missense	probably damaging	1.00
R4799:Cubn	UTSW	2	13,287,024 (GRCm38)	missense	possibly damaging	0.94
R4812:Cubn	UTSW	2	13,459,076 (GRCm38)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,325,225 (GRCm38)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,489,910 (GRCm38)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,348,045 (GRCm38)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,287,568 (GRCm38)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,478,202 (GRCm38)	nonsense	probably null
R5305:Cubn	UTSW	2	13,388,939 (GRCm38)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,491,695 (GRCm38)	splice site	probably null
R5530:Cubn	UTSW	2	13,308,523 (GRCm38)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,350,932 (GRCm38)	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13,388,891 (GRCm38)	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13,320,023 (GRCm38)	splice site	probably benign
R5923:Cubn	UTSW	2	13,486,078 (GRCm38)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,325,184 (GRCm38)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,325,184 (GRCm38)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,430,897 (GRCm38)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,427,847 (GRCm38)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,308,618 (GRCm38)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,349,876 (GRCm38)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,478,078 (GRCm38)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,280,195 (GRCm38)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,476,123 (GRCm38)	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13,427,835 (GRCm38)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,355,680 (GRCm38)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,294,203 (GRCm38)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,322,993 (GRCm38)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,459,002 (GRCm38)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,310,673 (GRCm38)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,430,872 (GRCm38)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,476,064 (GRCm38)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,321,255 (GRCm38)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,445,029 (GRCm38)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,444,253 (GRCm38)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,318,278 (GRCm38)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,348,029 (GRCm38)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,381,837 (GRCm38)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,486,789 (GRCm38)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,306,281 (GRCm38)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,306,280 (GRCm38)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,319,858 (GRCm38)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,342,498 (GRCm38)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,351,003 (GRCm38)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,424,739 (GRCm38)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,340,332 (GRCm38)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,468,771 (GRCm38)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,287,064 (GRCm38)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,426,967 (GRCm38)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,322,993 (GRCm38)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,322,993 (GRCm38)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,455,509 (GRCm38)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,489,917 (GRCm38)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,348,178 (GRCm38)	missense	probably benign
R7700:Cubn	UTSW	2	13,489,917 (GRCm38)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,348,178 (GRCm38)	missense	probably benign
R7751:Cubn	UTSW	2	13,360,365 (GRCm38)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,280,078 (GRCm38)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,348,150 (GRCm38)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,468,869 (GRCm38)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,424,727 (GRCm38)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,332,355 (GRCm38)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,336,086 (GRCm38)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,479,178 (GRCm38)	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13,331,660 (GRCm38)	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13,388,848 (GRCm38)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,294,318 (GRCm38)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,349,877 (GRCm38)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,486,802 (GRCm38)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,306,463 (GRCm38)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,340,242 (GRCm38)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,430,847 (GRCm38)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,428,724 (GRCm38)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,325,160 (GRCm38)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,428,756 (GRCm38)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,381,799 (GRCm38)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,427,847 (GRCm38)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,314,044 (GRCm38)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,308,520 (GRCm38)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,383,959 (GRCm38)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,308,566 (GRCm38)	nonsense	probably null
R8874:Cubn	UTSW	2	13,360,346 (GRCm38)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,456,655 (GRCm38)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,287,103 (GRCm38)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,332,465 (GRCm38)	splice site	probably benign
R9261:Cubn	UTSW	2	13,278,451 (GRCm38)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,381,892 (GRCm38)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,458,956 (GRCm38)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,287,699 (GRCm38)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,478,134 (GRCm38)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,321,180 (GRCm38)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,314,718 (GRCm38)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,428,719 (GRCm38)	missense	probably benign
X0018:Cubn	UTSW	2	13,458,986 (GRCm38)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,476,076 (GRCm38)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,342,581 (GRCm38)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,322,962 (GRCm38)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,383,992 (GRCm38)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,294,229 (GRCm38)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,381,825 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTACAAAATCTACACACTTTGGCC -3'
(R):5'- GGACTCTGTCATTCTGTCAAAATAC -3'

Sequencing Primer
(F):5'- TTTGGCCCAAAATAGTCCTCCAAG -3'
(R):5'- ACTCCTGAAATTCAAGTACAG -3'

Posted On

2018-04-27