Incidental Mutation 'R6368:Olfr1311'
ID512776
Institutional Source Beutler Lab
Gene Symbol Olfr1311
Ensembl Gene ENSMUSG00000109403
Gene Nameolfactory receptor 1311
SynonymsGA_x6K02T2Q125-73069292-73068354, MOR245-21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112019656-112024412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112021551 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 101 (I101N)
Ref Sequence ENSEMBL: ENSMUSP00000150617 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208536
AA Change: I101N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213602
AA Change: I101N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215321
AA Change: I101N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216319
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Olfr1311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1311 APN 2 112021132 missense probably damaging 1.00
IGL02626:Olfr1311 APN 2 112021113 missense probably damaging 1.00
R0499:Olfr1311 UTSW 2 112021432 missense probably damaging 1.00
R1511:Olfr1311 UTSW 2 112021404 missense probably benign 0.00
R3439:Olfr1311 UTSW 2 112021447 missense possibly damaging 0.95
R4564:Olfr1311 UTSW 2 112021767 missense possibly damaging 0.80
R4756:Olfr1311 UTSW 2 112020987 missense possibly damaging 0.52
R4776:Olfr1311 UTSW 2 112020931 missense probably benign 0.01
R5777:Olfr1311 UTSW 2 112021531 missense probably damaging 1.00
R5936:Olfr1311 UTSW 2 112021587 missense probably benign 0.38
R6283:Olfr1311 UTSW 2 112021260 missense possibly damaging 0.91
R6484:Olfr1311 UTSW 2 112021419 nonsense probably null
R7373:Olfr1311 UTSW 2 112021442 missense probably benign
X0065:Olfr1311 UTSW 2 112021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACAAAAGCTAGTTGGGCCAC -3'
(R):5'- TCCTCCATGTTCTACATAGCGAG -3'

Sequencing Primer
(F):5'- TTGGGCCACTGAGTGAATAAGTCC -3'
(R):5'- CCATGTTCTACATAGCGAGTGTGATG -3'
Posted On2018-04-27