Incidental Mutation 'R6368:Luzp1'
ID512780
Institutional Source Beutler Lab
Gene Symbol Luzp1
Ensembl Gene ENSMUSG00000001089
Gene Nameleucine zipper protein 1
SynonymsLuzp, 2700072H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location136469761-136554780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136541780 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 438 (M438K)
Ref Sequence ENSEMBL: ENSMUSP00000130758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001116] [ENSMUST00000063021] [ENSMUST00000105849] [ENSMUST00000129230] [ENSMUST00000168936] [ENSMUST00000170102]
Predicted Effect probably benign
Transcript: ENSMUST00000001116
AA Change: M438K

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000001116
Gene: ENSMUSG00000001089
AA Change: M438K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000063021
AA Change: M438K

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060619
Gene: ENSMUSG00000001089
AA Change: M438K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000105849
AA Change: M438K

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101475
Gene: ENSMUSG00000001089
AA Change: M438K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000129230
SMART Domains Protein: ENSMUSP00000128591
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
coiled coil region 11 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably benign
Transcript: ENSMUST00000170102
AA Change: M438K

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130758
Gene: ENSMUSG00000001089
AA Change: M438K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a leucine zipper motif. The exact function of the encoded protein is not known. In mice this gene affects neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Gene inactivation causes defective neural tube closure (exencephaly) and massive apoptosis in the hindbrain. Despite the incomplete penetrance of NTD, all homozygotes die perinatally due to complex cardiovascular anomalies. Other defects include an eyelid fusion defect, omphalocele and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Luzp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Luzp1 APN 4 136542776 missense probably damaging 1.00
IGL01766:Luzp1 APN 4 136542773 missense possibly damaging 0.92
IGL01868:Luzp1 APN 4 136542737 missense probably damaging 1.00
IGL03230:Luzp1 APN 4 136542878 missense probably benign 0.02
FR4548:Luzp1 UTSW 4 136543188 small insertion probably benign
FR4737:Luzp1 UTSW 4 136543196 small insertion probably benign
R0106:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R0674:Luzp1 UTSW 4 136543457 missense possibly damaging 0.85
R0676:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R1103:Luzp1 UTSW 4 136540730 missense possibly damaging 0.87
R1541:Luzp1 UTSW 4 136543325 missense probably damaging 1.00
R1812:Luzp1 UTSW 4 136542331 missense probably benign 0.03
R3924:Luzp1 UTSW 4 136542857 missense probably damaging 1.00
R4022:Luzp1 UTSW 4 136542193 missense probably benign 0.02
R4449:Luzp1 UTSW 4 136540863 missense probably damaging 1.00
R4976:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5119:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5411:Luzp1 UTSW 4 136543342 missense possibly damaging 0.59
R5659:Luzp1 UTSW 4 136542476 missense probably damaging 1.00
R5765:Luzp1 UTSW 4 136541029 missense probably damaging 0.98
R5828:Luzp1 UTSW 4 136540682 missense probably damaging 1.00
R6059:Luzp1 UTSW 4 136541480 missense probably benign 0.35
R6147:Luzp1 UTSW 4 136541063 missense probably damaging 1.00
R6181:Luzp1 UTSW 4 136543267 missense probably benign 0.01
R6200:Luzp1 UTSW 4 136541266 missense probably benign 0.12
R6581:Luzp1 UTSW 4 136540631 missense probably damaging 1.00
R6695:Luzp1 UTSW 4 136545298 missense possibly damaging 0.83
R6932:Luzp1 UTSW 4 136540813 nonsense probably null
R6998:Luzp1 UTSW 4 136543444 missense probably damaging 1.00
R7529:Luzp1 UTSW 4 136540932 missense probably damaging 1.00
R7878:Luzp1 UTSW 4 136541852 missense probably benign 0.00
R8077:Luzp1 UTSW 4 136543091 missense probably damaging 1.00
R8154:Luzp1 UTSW 4 136541884 missense possibly damaging 0.47
R8292:Luzp1 UTSW 4 136542453 missense probably benign 0.01
RF028:Luzp1 UTSW 4 136543196 small insertion probably benign
RF033:Luzp1 UTSW 4 136543196 small insertion probably benign
RF040:Luzp1 UTSW 4 136543196 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTTTTGGGCAGAGGCAG -3'
(R):5'- TAAGTCCACTCTCAGTGCCTGG -3'

Sequencing Primer
(F):5'- CTAAGCTCAAAGGCCATGGG -3'
(R):5'- GCTTGGGAGCTCCTTTCCAAAC -3'
Posted On2018-04-27