Mutagenetix > Incidental Mutations

Incidental Mutation 'R6368:Kel'

512784

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R6368 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 41688851 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 174 (C174*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]

Predicted Effect

probably null
Transcript: ENSMUST00000031899
AA Change: C492*

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: C492*

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031900

SMART Domains

Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:DUF4717	37	107	7.8e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153760

Predicted Effect

probably null
Transcript: ENSMUST00000192118
AA Change: C174*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192406

Predicted Effect

probably benign
Transcript: ENSMUST00000194597

SMART Domains

Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M13	16	68	3.6e-10	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 55,990,132	E272D	possibly damaging	Het
Abi2	A	G	1: 60,453,651	T158A	possibly damaging	Het
Acacb	T	C	5: 114,216,823	S1221P	probably damaging	Het
Agbl1	A	G	7: 76,419,830	D370G	probably benign	Het
Apeh	A	G	9: 108,087,243	I487T	probably damaging	Het
Arid1b	C	A	17: 5,332,533	N1297K	possibly damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atp7b	A	C	8: 22,020,755		probably null	Het
Bsn	C	T	9: 108,111,314		probably benign	Het
Caps2	C	T	10: 112,194,968	Q268*	probably null	Het
Cnfn	C	T	7: 25,367,961		probably null	Het
Cr2	A	G	1: 195,168,472	S229P	probably damaging	Het
Cubn	T	C	2: 13,430,995	Y1050C	probably damaging	Het
Cubn	T	C	2: 13,476,123	E307G	probably damaging	Het
Cyb5r3	A	C	15: 83,160,124	Y182D	possibly damaging	Het
Dclre1a	A	T	19: 56,546,791	H120Q	probably benign	Het
Ddx6	T	C	9: 44,635,776	I457T	probably damaging	Het
E2f1	A	T	2: 154,564,476	H93Q	possibly damaging	Het
Fam186a	T	C	15: 99,943,317	K1682R	possibly damaging	Het
Farsb	A	G	1: 78,466,965		probably null	Het
Flii	A	T	11: 60,721,136	L347Q	probably damaging	Het
Galntl6	T	G	8: 58,911,441	T12P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm21680	T	C	5: 25,969,036	N190S	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,125	S364G	probably benign	Het
Kdm2a	A	G	19: 4,350,317	I234T	probably damaging	Het
Kdm5b	T	C	1: 134,599,207	C356R	probably damaging	Het
Krt16	T	A	11: 100,246,676	D401V	probably damaging	Het
Ltb4r1	A	C	14: 55,767,743	I168L	probably benign	Het
Luzp1	T	A	4: 136,541,780	M438K	probably benign	Het
Mtf1	C	T	4: 124,824,352	T281M	probably damaging	Het
Myo9a	T	A	9: 59,924,948	S2587T	probably benign	Het
Olfr1311	A	T	2: 112,021,551	I101N	probably damaging	Het
Olfr1377	T	A	11: 50,984,786	F28L	probably benign	Het
Olfr532	G	T	7: 140,419,667	Y35*	probably null	Het
Olfr860	T	C	9: 19,846,409	D70G	probably damaging	Het
Pcm1	T	A	8: 41,293,544	F1221Y	probably benign	Het
Pnldc1	A	T	17: 12,905,864	N90K	probably damaging	Het
Prickle2	A	T	6: 92,420,237	L169Q	probably damaging	Het
Ralgps2	A	T	1: 156,884,574	L147I	probably damaging	Het
Rfx3	A	T	19: 27,768,609	L674Q	possibly damaging	Het
Rpl3	C	A	15: 80,082,544	L14F	probably damaging	Het
Rrbp1	C	T	2: 143,989,555	G231R	probably damaging	Het
Sema3d	C	T	5: 12,571,013	L529F	probably damaging	Het
Slain1	A	T	14: 103,656,955	T193S	probably benign	Het
Slc2a6	G	T	2: 27,024,587	Q256K	possibly damaging	Het
Slk	A	G	19: 47,620,183	E525G	possibly damaging	Het
Spsb4	G	T	9: 96,944,645	Q252K	probably benign	Het
Taf1b	A	G	12: 24,558,257	T552A	possibly damaging	Het
Tmprss15	T	C	16: 79,006,057		probably null	Het
Tph2	T	C	10: 115,179,326	H177R	probably damaging	Het
Ttll1	A	G	15: 83,489,617	S332P	probably damaging	Het
Twf2	T	G	9: 106,212,833	N128K	probably benign	Het
Vegfc	T	A	8: 54,181,230	C315S	probably damaging	Het
Vmn2r111	T	A	17: 22,571,908	K136N	probably benign	Het
Wnk2	T	C	13: 49,061,338	E496G	probably damaging	Het
Zfp148	C	A	16: 33,497,198	Q705K	probably damaging	Het
Zw10	C	T	9: 49,073,235	A539V	probably damaging	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATTTCTGCCATCTGTGTGAAG -3'
(R):5'- CATGTGAACTTTGGGCAAATGTG -3'

Sequencing Primer
(F):5'- CTGCCATCTGTGTGAAGAATACAC -3'
(R):5'- TGGGCAAATGTGAGGTGATATTAC -3'

Posted On

2018-04-27