Mutagenetix > Incidental Mutations

Incidental Mutation 'R6368:Prickle2'

512785

Institutional Source

Beutler Lab

Gene Symbol

Prickle2

Ensembl Gene

ENSMUSG00000030020

Gene Name

prickle planar cell polarity protein 2

Synonyms

6230400G14Rik, mpk2, 6720451F06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.628) question?

Stock #

R6368 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92370908-92706155 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92420237 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 169 (L169Q)

Ref Sequence

ENSEMBL: ENSMUSP00000109074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032093
AA Change: L225Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: L225Q

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Pfam:PET	76	176	1.2e-45	PFAM
LIM	185	242	3.05e-10	SMART
LIM	250	302	5.43e-16	SMART
LIM	310	365	2.92e-7	SMART
low complexity region	465	477	N/A	INTRINSIC
low complexity region	534	546	N/A	INTRINSIC
low complexity region	725	753	N/A	INTRINSIC
low complexity region	832	841	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113445
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: L169Q

Domain	Start	End	E-Value	Type
Pfam:PET	17	122	8.9e-47	PFAM
LIM	129	186	3.05e-10	SMART
LIM	194	246	5.43e-16	SMART
LIM	254	309	2.92e-7	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	776	785	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113446
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: L169Q

Domain	Start	End	E-Value	Type
Pfam:PET	17	122	8.9e-47	PFAM
LIM	129	186	3.05e-10	SMART
LIM	194	246	5.43e-16	SMART
LIM	254	309	2.92e-7	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	776	785	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113447
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: L169Q

Domain	Start	End	E-Value	Type
Pfam:PET	17	122	8.9e-47	PFAM
LIM	129	186	3.05e-10	SMART
LIM	194	246	5.43e-16	SMART
LIM	254	309	2.92e-7	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	776	785	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 55,990,132	E272D	possibly damaging	Het
Abi2	A	G	1: 60,453,651	T158A	possibly damaging	Het
Acacb	T	C	5: 114,216,823	S1221P	probably damaging	Het
Agbl1	A	G	7: 76,419,830	D370G	probably benign	Het
Apeh	A	G	9: 108,087,243	I487T	probably damaging	Het
Arid1b	C	A	17: 5,332,533	N1297K	possibly damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atp7b	A	C	8: 22,020,755		probably null	Het
Bsn	C	T	9: 108,111,314		probably benign	Het
Caps2	C	T	10: 112,194,968	Q268*	probably null	Het
Cnfn	C	T	7: 25,367,961		probably null	Het
Cr2	A	G	1: 195,168,472	S229P	probably damaging	Het
Cubn	T	C	2: 13,430,995	Y1050C	probably damaging	Het
Cubn	T	C	2: 13,476,123	E307G	probably damaging	Het
Cyb5r3	A	C	15: 83,160,124	Y182D	possibly damaging	Het
Dclre1a	A	T	19: 56,546,791	H120Q	probably benign	Het
Ddx6	T	C	9: 44,635,776	I457T	probably damaging	Het
E2f1	A	T	2: 154,564,476	H93Q	possibly damaging	Het
Fam186a	T	C	15: 99,943,317	K1682R	possibly damaging	Het
Farsb	A	G	1: 78,466,965		probably null	Het
Flii	A	T	11: 60,721,136	L347Q	probably damaging	Het
Galntl6	T	G	8: 58,911,441	T12P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm21680	T	C	5: 25,969,036	N190S	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,125	S364G	probably benign	Het
Kdm2a	A	G	19: 4,350,317	I234T	probably damaging	Het
Kdm5b	T	C	1: 134,599,207	C356R	probably damaging	Het
Kel	A	T	6: 41,688,851	C174*	probably null	Het
Krt16	T	A	11: 100,246,676	D401V	probably damaging	Het
Ltb4r1	A	C	14: 55,767,743	I168L	probably benign	Het
Luzp1	T	A	4: 136,541,780	M438K	probably benign	Het
Mtf1	C	T	4: 124,824,352	T281M	probably damaging	Het
Myo9a	T	A	9: 59,924,948	S2587T	probably benign	Het
Olfr1311	A	T	2: 112,021,551	I101N	probably damaging	Het
Olfr1377	T	A	11: 50,984,786	F28L	probably benign	Het
Olfr532	G	T	7: 140,419,667	Y35*	probably null	Het
Olfr860	T	C	9: 19,846,409	D70G	probably damaging	Het
Pcm1	T	A	8: 41,293,544	F1221Y	probably benign	Het
Pnldc1	A	T	17: 12,905,864	N90K	probably damaging	Het
Ralgps2	A	T	1: 156,884,574	L147I	probably damaging	Het
Rfx3	A	T	19: 27,768,609	L674Q	possibly damaging	Het
Rpl3	C	A	15: 80,082,544	L14F	probably damaging	Het
Rrbp1	C	T	2: 143,989,555	G231R	probably damaging	Het
Sema3d	C	T	5: 12,571,013	L529F	probably damaging	Het
Slain1	A	T	14: 103,656,955	T193S	probably benign	Het
Slc2a6	G	T	2: 27,024,587	Q256K	possibly damaging	Het
Slk	A	G	19: 47,620,183	E525G	possibly damaging	Het
Spsb4	G	T	9: 96,944,645	Q252K	probably benign	Het
Taf1b	A	G	12: 24,558,257	T552A	possibly damaging	Het
Tmprss15	T	C	16: 79,006,057		probably null	Het
Tph2	T	C	10: 115,179,326	H177R	probably damaging	Het
Ttll1	A	G	15: 83,489,617	S332P	probably damaging	Het
Twf2	T	G	9: 106,212,833	N128K	probably benign	Het
Vegfc	T	A	8: 54,181,230	C315S	probably damaging	Het
Vmn2r111	T	A	17: 22,571,908	K136N	probably benign	Het
Wnk2	T	C	13: 49,061,338	E496G	probably damaging	Het
Zfp148	C	A	16: 33,497,198	Q705K	probably damaging	Het
Zw10	C	T	9: 49,073,235	A539V	probably damaging	Het

Other mutations in Prickle2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02962:Prickle2	APN	6	92376422	missense	probably benign	0.00
R0028:Prickle2	UTSW	6	92422342	missense	probably benign	0.12
R0122:Prickle2	UTSW	6	92411345	nonsense	probably null
R0555:Prickle2	UTSW	6	92458565	missense	probably benign	0.02
R0940:Prickle2	UTSW	6	92411003	missense	probably benign	0.02
R1394:Prickle2	UTSW	6	92376382	missense	possibly damaging	0.87
R1470:Prickle2	UTSW	6	92458602	missense	probably damaging	0.96
R1470:Prickle2	UTSW	6	92458602	missense	probably damaging	0.96
R1599:Prickle2	UTSW	6	92410874	missense	probably benign
R1745:Prickle2	UTSW	6	92376593	missense	probably damaging	1.00
R1801:Prickle2	UTSW	6	92416904	missense	probably damaging	0.98
R1985:Prickle2	UTSW	6	92411452	missense	probably damaging	1.00
R2085:Prickle2	UTSW	6	92376364	missense	probably damaging	0.96
R2147:Prickle2	UTSW	6	92425671	missense	probably damaging	0.99
R2148:Prickle2	UTSW	6	92425671	missense	probably damaging	0.99
R2571:Prickle2	UTSW	6	92705400	missense	probably benign	0.09
R3547:Prickle2	UTSW	6	92411137	missense	probably damaging	1.00
R4356:Prickle2	UTSW	6	92411509	missense	probably damaging	1.00
R4569:Prickle2	UTSW	6	92422342	missense	probably benign	0.12
R4896:Prickle2	UTSW	6	92416755	missense	probably benign	0.26
R5004:Prickle2	UTSW	6	92416755	missense	probably benign	0.26
R5045:Prickle2	UTSW	6	92376394	missense	probably damaging	0.96
R5219:Prickle2	UTSW	6	92376530	missense	probably benign
R5247:Prickle2	UTSW	6	92375969	missense	probably damaging	1.00
R5280:Prickle2	UTSW	6	92376210	missense	probably damaging	1.00
R5334:Prickle2	UTSW	6	92425684	missense	probably damaging	1.00
R5780:Prickle2	UTSW	6	92458612	missense	probably benign	0.06
R5960:Prickle2	UTSW	6	92376305	missense	probably benign	0.08
R6084:Prickle2	UTSW	6	92416848	nonsense	probably null
R6362:Prickle2	UTSW	6	92458615	missense	possibly damaging	0.77
R6852:Prickle2	UTSW	6	92376544	missense	probably benign
R7041:Prickle2	UTSW	6	92376305	missense	probably benign	0.08
R7203:Prickle2	UTSW	6	92410978	missense	possibly damaging	0.61
R7352:Prickle2	UTSW	6	92410890	missense	probably benign	0.00
R7405:Prickle2	UTSW	6	92458543	missense	probably damaging	0.96
R7510:Prickle2	UTSW	6	92376470	missense	possibly damaging	0.58
R7562:Prickle2	UTSW	6	92375948	makesense	probably null
R7578:Prickle2	UTSW	6	92411290	missense	probably benign	0.32
R7614:Prickle2	UTSW	6	92425650	missense	possibly damaging	0.46
R7732:Prickle2	UTSW	6	92411224	missense	probably damaging	1.00
R7948:Prickle2	UTSW	6	92416922	missense	possibly damaging	0.84
R7984:Prickle2	UTSW	6	92410874	missense	probably benign
R8350:Prickle2	UTSW	6	92376502	missense	probably benign
R8404:Prickle2	UTSW	6	92420321	missense	probably damaging	0.96
X0020:Prickle2	UTSW	6	92416853	missense	probably damaging	0.98
X0026:Prickle2	UTSW	6	92411426	nonsense	probably null
X0066:Prickle2	UTSW	6	92376433	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAAGGTGTCACCCCTATCTTC -3'
(R):5'- AAAGCAAGGGACTAACTAGTGTCC -3'

Sequencing Primer
(F):5'- CCTATCTTCCAGGAATATGCAGG -3'
(R):5'- CCCTAGTAGCTAGCCGTTGGTAATAG -3'

Posted On

2018-04-27