Incidental Mutation 'R6368:Pcm1'
ID512790
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Namepericentriolar material 1
Synonyms9430077F19Rik, 2600002H09Rik, C030044G17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location41239752-41332344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41293544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1221 (F1221Y)
Ref Sequence ENSEMBL: ENSMUSP00000039709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
Predicted Effect probably benign
Transcript: ENSMUST00000045218
AA Change: F1221Y

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: F1221Y

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211247
AA Change: F1260Y

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41274277 missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41287821 missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41276123 missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41287881 missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41309603 missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41257923 missense probably benign 0.00
IGL01888:Pcm1 APN 8 41257956 missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41288155 critical splice donor site probably null
IGL02562:Pcm1 APN 8 41325368 missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41330882 missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41275060 missense probably damaging 1.00
shaved UTSW 8 41288156 critical splice donor site probably null
D3080:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41288097 missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41256041 missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41257937 missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41276111 nonsense probably null
R0386:Pcm1 UTSW 8 41316023 missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41325905 missense probably benign 0.25
R0498:Pcm1 UTSW 8 41293769 missense probably benign 0.01
R0528:Pcm1 UTSW 8 41315930 missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41286051 missense probably damaging 0.99
R0635:Pcm1 UTSW 8 41267179 splice site probably benign
R0725:Pcm1 UTSW 8 41287811 missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41261020 missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41282683 missense probably damaging 1.00
R1027:Pcm1 UTSW 8 41293445 splice site probably benign
R1056:Pcm1 UTSW 8 41321900 missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41287701 missense probably benign
R1566:Pcm1 UTSW 8 41290773 missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41309635 missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41313359 missense possibly damaging 0.62
R1816:Pcm1 UTSW 8 41309537 missense probably damaging 0.99
R2177:Pcm1 UTSW 8 41275965 missense probably benign
R2495:Pcm1 UTSW 8 41293579 missense probably benign
R3737:Pcm1 UTSW 8 41261043 nonsense probably null
R3747:Pcm1 UTSW 8 41332004 missense probably benign 0.44
R3763:Pcm1 UTSW 8 41280077 missense probably damaging 1.00
R3764:Pcm1 UTSW 8 41330882 missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41258014 missense possibly damaging 0.66
R3968:Pcm1 UTSW 8 41325830 missense probably damaging 1.00
R4760:Pcm1 UTSW 8 41287738 missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41293678 missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41259260 missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41288156 critical splice donor site probably null
R5250:Pcm1 UTSW 8 41312205 missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41272462 critical splice donor site probably null
R5470:Pcm1 UTSW 8 41287683 missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41328979 missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41328778 missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41283632 missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41293793 missense probably benign 0.23
R6227:Pcm1 UTSW 8 41330825 missense probably damaging 0.99
R6438:Pcm1 UTSW 8 41325381 missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41261036 missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41293510 missense probably benign 0.11
R7401:Pcm1 UTSW 8 41309531 missense probably damaging 1.00
R7478:Pcm1 UTSW 8 41261373 missense probably benign 0.17
R7570:Pcm1 UTSW 8 41267344 missense possibly damaging 0.64
R7648:Pcm1 UTSW 8 41275699 missense probably damaging 0.99
R7773:Pcm1 UTSW 8 41309573 nonsense probably null
R7779:Pcm1 UTSW 8 41329024 missense probably damaging 1.00
R7842:Pcm1 UTSW 8 41327584 missense possibly damaging 0.54
R7863:Pcm1 UTSW 8 41261126 missense probably damaging 0.99
R7925:Pcm1 UTSW 8 41327584 missense possibly damaging 0.54
R7946:Pcm1 UTSW 8 41261126 missense probably damaging 0.99
X0025:Pcm1 UTSW 8 41330642 missense probably damaging 1.00
Z1177:Pcm1 UTSW 8 41274171 missense not run
Z1177:Pcm1 UTSW 8 41287744 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGTGTTTTCCTAGCCTGTTG -3'
(R):5'- TTTTGTCCTTAGAGGCCAGGC -3'

Sequencing Primer
(F):5'- TCCTAGCCTGTTGATTTTATTAACC -3'
(R):5'- GCCTGGGCAGATGCTTTTC -3'
Posted On2018-04-27