Incidental Mutation 'R6368:Olfr860'
ID512793
Institutional Source Beutler Lab
Gene Symbol Olfr860
Ensembl Gene ENSMUSG00000066905
Gene Nameolfactory receptor 860
SynonymsMOR146-2, GA_x6K02T2PVTD-13586614-13585661
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19845156-19849747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19846409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000148658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086482] [ENSMUST00000211924] [ENSMUST00000212353]
Predicted Effect probably damaging
Transcript: ENSMUST00000086482
AA Change: D70G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130735
Gene: ENSMUSG00000066905
AA Change: D70G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.5e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.1e-8 PFAM
Pfam:7tm_1 41 290 9.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211924
AA Change: D70G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000212353
AA Change: D70G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212838
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Olfr860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Olfr860 APN 9 19846259 missense probably damaging 1.00
IGL02216:Olfr860 APN 9 19846565 missense probably damaging 0.99
IGL02269:Olfr860 APN 9 19845728 missense possibly damaging 0.85
IGL02964:Olfr860 APN 9 19846254 nonsense probably null
R0042:Olfr860 UTSW 9 19845779 missense probably benign
R1505:Olfr860 UTSW 9 19845788 missense probably benign 0.39
R1941:Olfr860 UTSW 9 19845950 missense probably damaging 0.99
R2030:Olfr860 UTSW 9 19846413 missense probably benign 0.30
R3150:Olfr860 UTSW 9 19846214 missense possibly damaging 0.80
R4597:Olfr860 UTSW 9 19845691 missense probably benign 0.01
R5004:Olfr860 UTSW 9 19846102 missense probably benign 0.00
R5006:Olfr860 UTSW 9 19846271 missense probably benign 0.33
R5350:Olfr860 UTSW 9 19846616 start codon destroyed probably null 0.97
R6163:Olfr860 UTSW 9 19845728 missense probably benign 0.45
R7206:Olfr860 UTSW 9 19846560 missense probably damaging 0.99
R7315:Olfr860 UTSW 9 19845835 missense probably damaging 0.99
R8195:Olfr860 UTSW 9 19846484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCTGTGAATCAATGAGAC -3'
(R):5'- TCCTTGGACTCTCAGAGGAC -3'

Sequencing Primer
(F):5'- CACCTGTGAATCAATGAGACTGATAC -3'
(R):5'- TGGACTCTCAGAGGACCCTGAAC -3'
Posted On2018-04-27