Incidental Mutation 'R6368:Apeh'
ID512800
Institutional Source Beutler Lab
Gene Symbol Apeh
Ensembl Gene ENSMUSG00000032590
Gene Nameacylpeptide hydrolase
SynonymsN-acylaminoacyl peptide hydrolase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108085413-108094606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108087243 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 487 (I487T)
Ref Sequence ENSEMBL: ENSMUSP00000141856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000162886] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect unknown
Transcript: ENSMUST00000081309
AA Change: I485T
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590
AA Change: I485T

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect probably damaging
Transcript: ENSMUST00000193254
AA Change: I487T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590
AA Change: I487T

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme acylpeptide hydrolase, which catalyzes the hydrolysis of the terminal acetylated amino acid preferentially from small acetylated peptides. The acetyl amino acid formed by this hydrolase is further processed to acetate and a free amino acid by an aminoacylase. This gene is located within the same region of chromosome 3 (3p21) as the aminoacylase gene, and deletions at this locus are also associated with a decrease in aminoacylase activity. The acylpeptide hydrolase is a homotetrameric protein of 300 kDa with each subunit consisting of 732 amino acid residues. It can play an important role in destroying oxidatively damaged proteins in living cells. Deletions of this gene locus are found in various types of carcinomas, including small cell lung carcinoma and renal cell carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Apeh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Apeh APN 9 108086207 missense probably benign
IGL02232:Apeh APN 9 108091872 missense probably benign 0.02
IGL02563:Apeh APN 9 108093709 missense possibly damaging 0.85
IGL02713:Apeh APN 9 108085672 missense probably damaging 1.00
IGL02794:Apeh APN 9 108092010 missense possibly damaging 0.94
IGL03355:Apeh APN 9 108086445 missense probably benign 0.00
R6807_Apeh_606 UTSW 9 108092679 missense probably damaging 1.00
R0511:Apeh UTSW 9 108087055 missense probably benign
R1221:Apeh UTSW 9 108092609 missense probably benign
R1574:Apeh UTSW 9 108092726 splice site probably null
R1863:Apeh UTSW 9 108092103 missense possibly damaging 0.91
R2126:Apeh UTSW 9 108085667 missense probably damaging 1.00
R2353:Apeh UTSW 9 108086292 missense possibly damaging 0.84
R4930:Apeh UTSW 9 108087825 missense probably benign
R5156:Apeh UTSW 9 108094287 missense probably damaging 1.00
R5278:Apeh UTSW 9 108091258 missense probably benign 0.08
R5366:Apeh UTSW 9 108091806 missense probably benign 0.01
R5384:Apeh UTSW 9 108086463 missense probably damaging 1.00
R5940:Apeh UTSW 9 108091899 splice site probably null
R6102:Apeh UTSW 9 108086439 missense probably damaging 1.00
R6300:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6807:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6809:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6817:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6828:Apeh UTSW 9 108087038 missense probably damaging 1.00
R6866:Apeh UTSW 9 108092679 missense probably damaging 1.00
R7034:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7036:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7139:Apeh UTSW 9 108092146 missense probably damaging 1.00
R8024:Apeh UTSW 9 108092591 missense probably benign 0.20
R8289:Apeh UTSW 9 108086245 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCATCTTGCAAAGCATGG -3'
(R):5'- AAGTGCATGAGCTTTAGGGG -3'

Sequencing Primer
(F):5'- CATCTTGCAAAGCATGGCTGGG -3'
(R):5'- AGCTTTAGGGGGCTCCATG -3'
Posted On2018-04-27