Incidental Mutation 'R6368:Olfr1377'
ID512805
Institutional Source Beutler Lab
Gene Symbol Olfr1377
Ensembl Gene ENSMUSG00000061952
Gene Nameolfactory receptor 1377
SynonymsMOR129-1, GA_x6K02T2QP88-4453480-4452557
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50981967-50986593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50984786 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 28 (F28L)
Ref Sequence ENSEMBL: ENSMUSP00000151087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075177] [ENSMUST00000213291] [ENSMUST00000216101]
Predicted Effect probably benign
Transcript: ENSMUST00000075177
AA Change: F28L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074672
Gene: ENSMUSG00000061952
AA Change: F28L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-51 PFAM
Pfam:7tm_1 41 289 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118780
Predicted Effect probably benign
Transcript: ENSMUST00000213291
AA Change: F28L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216101
AA Change: F28L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Olfr1377
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1377 APN 11 50985003 missense possibly damaging 0.94
R1386:Olfr1377 UTSW 11 50985367 missense probably damaging 0.97
R1486:Olfr1377 UTSW 11 50984781 missense probably benign 0.00
R1613:Olfr1377 UTSW 11 50985218 missense probably damaging 1.00
R2224:Olfr1377 UTSW 11 50985232 missense probably damaging 1.00
R2411:Olfr1377 UTSW 11 50984931 missense probably damaging 0.98
R3014:Olfr1377 UTSW 11 50984707 missense probably benign 0.00
R4080:Olfr1377 UTSW 11 50984856 missense probably damaging 1.00
R4753:Olfr1377 UTSW 11 50985151 missense probably benign 0.05
R4764:Olfr1377 UTSW 11 50984775 missense probably benign 0.00
R4822:Olfr1377 UTSW 11 50985083 nonsense probably null
R4865:Olfr1377 UTSW 11 50985543 missense probably damaging 0.99
R5053:Olfr1377 UTSW 11 50985310 missense probably damaging 1.00
R6054:Olfr1377 UTSW 11 50984804 missense probably benign 0.00
R7589:Olfr1377 UTSW 11 50985030 missense probably damaging 0.98
R7843:Olfr1377 UTSW 11 50985018 missense probably benign 0.06
R8056:Olfr1377 UTSW 11 50985541 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTCCATCAACCAGTAAAGCATTG -3'
(R):5'- TCTGGATCATGCACTCTGTG -3'

Sequencing Primer
(F):5'- TCAACCAGTAAAGCATTGCAAGATAG -3'
(R):5'- AAGAGATGGACTTGCTTCCC -3'
Posted On2018-04-27