Mutagenetix > Incidental Mutations

Incidental Mutation 'R6368:Taf1b'

512809

Institutional Source

Beutler Lab

Gene Symbol

Taf1b

Ensembl Gene

ENSMUSG00000059669

Gene Name

TATA-box binding protein associated factor, RNA polymerase I, B

Synonyms

A230108M10Rik, mTAFI68, p63, 4930408G01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R6368 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24498359-24558539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24558257 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 552 (T552A)

Ref Sequence

ENSEMBL: ENSMUSP00000075339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075954
AA Change: T552A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669
AA Change: T552A

Domain	Start	End	E-Value	Type
Pfam:RRN7	3	39	7.3e-15	PFAM
low complexity region	141	153	N/A	INTRINSIC
low complexity region	361	374	N/A	INTRINSIC
low complexity region	411	425	N/A	INTRINSIC
low complexity region	574	583	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221372

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 55,990,132	E272D	possibly damaging	Het
Abi2	A	G	1: 60,453,651	T158A	possibly damaging	Het
Acacb	T	C	5: 114,216,823	S1221P	probably damaging	Het
Agbl1	A	G	7: 76,419,830	D370G	probably benign	Het
Apeh	A	G	9: 108,087,243	I487T	probably damaging	Het
Arid1b	C	A	17: 5,332,533	N1297K	possibly damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atp7b	A	C	8: 22,020,755		probably null	Het
Bsn	C	T	9: 108,111,314		probably benign	Het
Caps2	C	T	10: 112,194,968	Q268*	probably null	Het
Cnfn	C	T	7: 25,367,961		probably null	Het
Cr2	A	G	1: 195,168,472	S229P	probably damaging	Het
Cubn	T	C	2: 13,430,995	Y1050C	probably damaging	Het
Cubn	T	C	2: 13,476,123	E307G	probably damaging	Het
Cyb5r3	A	C	15: 83,160,124	Y182D	possibly damaging	Het
Dclre1a	A	T	19: 56,546,791	H120Q	probably benign	Het
Ddx6	T	C	9: 44,635,776	I457T	probably damaging	Het
E2f1	A	T	2: 154,564,476	H93Q	possibly damaging	Het
Fam186a	T	C	15: 99,943,317	K1682R	possibly damaging	Het
Farsb	A	G	1: 78,466,965		probably null	Het
Flii	A	T	11: 60,721,136	L347Q	probably damaging	Het
Galntl6	T	G	8: 58,911,441	T12P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm21680	T	C	5: 25,969,036	N190S	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,125	S364G	probably benign	Het
Kdm2a	A	G	19: 4,350,317	I234T	probably damaging	Het
Kdm5b	T	C	1: 134,599,207	C356R	probably damaging	Het
Kel	A	T	6: 41,688,851	C174*	probably null	Het
Krt16	T	A	11: 100,246,676	D401V	probably damaging	Het
Ltb4r1	A	C	14: 55,767,743	I168L	probably benign	Het
Luzp1	T	A	4: 136,541,780	M438K	probably benign	Het
Mtf1	C	T	4: 124,824,352	T281M	probably damaging	Het
Myo9a	T	A	9: 59,924,948	S2587T	probably benign	Het
Olfr1311	A	T	2: 112,021,551	I101N	probably damaging	Het
Olfr1377	T	A	11: 50,984,786	F28L	probably benign	Het
Olfr532	G	T	7: 140,419,667	Y35*	probably null	Het
Olfr860	T	C	9: 19,846,409	D70G	probably damaging	Het
Pcm1	T	A	8: 41,293,544	F1221Y	probably benign	Het
Pnldc1	A	T	17: 12,905,864	N90K	probably damaging	Het
Prickle2	A	T	6: 92,420,237	L169Q	probably damaging	Het
Ralgps2	A	T	1: 156,884,574	L147I	probably damaging	Het
Rfx3	A	T	19: 27,768,609	L674Q	possibly damaging	Het
Rpl3	C	A	15: 80,082,544	L14F	probably damaging	Het
Rrbp1	C	T	2: 143,989,555	G231R	probably damaging	Het
Sema3d	C	T	5: 12,571,013	L529F	probably damaging	Het
Slain1	A	T	14: 103,656,955	T193S	probably benign	Het
Slc2a6	G	T	2: 27,024,587	Q256K	possibly damaging	Het
Slk	A	G	19: 47,620,183	E525G	possibly damaging	Het
Spsb4	G	T	9: 96,944,645	Q252K	probably benign	Het
Tmprss15	T	C	16: 79,006,057		probably null	Het
Tph2	T	C	10: 115,179,326	H177R	probably damaging	Het
Ttll1	A	G	15: 83,489,617	S332P	probably damaging	Het
Twf2	T	G	9: 106,212,833	N128K	probably benign	Het
Vegfc	T	A	8: 54,181,230	C315S	probably damaging	Het
Vmn2r111	T	A	17: 22,571,908	K136N	probably benign	Het
Wnk2	T	C	13: 49,061,338	E496G	probably damaging	Het
Zfp148	C	A	16: 33,497,198	Q705K	probably damaging	Het
Zw10	C	T	9: 49,073,235	A539V	probably damaging	Het

Other mutations in Taf1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Taf1b	APN	12	24547067	missense	possibly damaging	0.86
IGL01460:Taf1b	APN	12	24558246	missense	possibly damaging	0.96
IGL02100:Taf1b	APN	12	24544395	missense	possibly damaging	0.96
IGL02305:Taf1b	APN	12	24544271	missense	possibly damaging	0.73
IGL02729:Taf1b	APN	12	24547625	splice site	probably benign
PIT4283001:Taf1b	UTSW	12	24547595	missense	possibly damaging	0.86
PIT4519001:Taf1b	UTSW	12	24547119	nonsense	probably null
R0350:Taf1b	UTSW	12	24514885	missense	possibly damaging	0.85
R0853:Taf1b	UTSW	12	24514828	missense	probably benign	0.06
R1023:Taf1b	UTSW	12	24509559	utr 3 prime	probably benign
R1604:Taf1b	UTSW	12	24556624	missense	probably benign
R1702:Taf1b	UTSW	12	24509126	missense	possibly damaging	0.73
R1743:Taf1b	UTSW	12	24547178	missense	possibly damaging	0.85
R1817:Taf1b	UTSW	12	24547122	missense	possibly damaging	0.70
R1873:Taf1b	UTSW	12	24556669	missense	possibly damaging	0.96
R4595:Taf1b	UTSW	12	24500442	missense	possibly damaging	0.85
R5280:Taf1b	UTSW	12	24549438	missense	probably benign	0.18
R5838:Taf1b	UTSW	12	24500449	missense	possibly damaging	0.92
R5849:Taf1b	UTSW	12	24500525	missense	probably damaging	1.00
R6529:Taf1b	UTSW	12	24556651	missense	possibly damaging	0.53
R6589:Taf1b	UTSW	12	24556528	missense	possibly damaging	0.72
R6879:Taf1b	UTSW	12	24500517	missense	possibly damaging	0.71
R7342:Taf1b	UTSW	12	24558344	nonsense	probably null
R7449:Taf1b	UTSW	12	24504993	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GTTTAAAGCTGCTGCATCTACTG -3'
(R):5'- CATGCCAAAGTGTATGCCTG -3'

Sequencing Primer
(F):5'- TAAAGCTGCTGCATCTACTGGTGAG -3'
(R):5'- GCCAAAGTGTATGCCTGTTCAACAG -3'

Posted On

2018-04-27