Incidental Mutation 'R6368:Taf1b'
ID512809
Institutional Source Beutler Lab
Gene Symbol Taf1b
Ensembl Gene ENSMUSG00000059669
Gene NameTATA-box binding protein associated factor, RNA polymerase I, B
SynonymsA230108M10Rik, mTAFI68, p63, 4930408G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location24498359-24558539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24558257 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 552 (T552A)
Ref Sequence ENSEMBL: ENSMUSP00000075339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075954
AA Change: T552A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669
AA Change: T552A

DomainStartEndE-ValueType
Pfam:RRN7 3 39 7.3e-15 PFAM
low complexity region 141 153 N/A INTRINSIC
low complexity region 361 374 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
low complexity region 574 583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221372
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Taf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Taf1b APN 12 24547067 missense possibly damaging 0.86
IGL01460:Taf1b APN 12 24558246 missense possibly damaging 0.96
IGL02100:Taf1b APN 12 24544395 missense possibly damaging 0.96
IGL02305:Taf1b APN 12 24544271 missense possibly damaging 0.73
IGL02729:Taf1b APN 12 24547625 splice site probably benign
PIT4283001:Taf1b UTSW 12 24547595 missense possibly damaging 0.86
PIT4519001:Taf1b UTSW 12 24547119 nonsense probably null
R0350:Taf1b UTSW 12 24514885 missense possibly damaging 0.85
R0853:Taf1b UTSW 12 24514828 missense probably benign 0.06
R1023:Taf1b UTSW 12 24509559 utr 3 prime probably benign
R1604:Taf1b UTSW 12 24556624 missense probably benign
R1702:Taf1b UTSW 12 24509126 missense possibly damaging 0.73
R1743:Taf1b UTSW 12 24547178 missense possibly damaging 0.85
R1817:Taf1b UTSW 12 24547122 missense possibly damaging 0.70
R1873:Taf1b UTSW 12 24556669 missense possibly damaging 0.96
R4595:Taf1b UTSW 12 24500442 missense possibly damaging 0.85
R5280:Taf1b UTSW 12 24549438 missense probably benign 0.18
R5838:Taf1b UTSW 12 24500449 missense possibly damaging 0.92
R5849:Taf1b UTSW 12 24500525 missense probably damaging 1.00
R6529:Taf1b UTSW 12 24556651 missense possibly damaging 0.53
R6589:Taf1b UTSW 12 24556528 missense possibly damaging 0.72
R6879:Taf1b UTSW 12 24500517 missense possibly damaging 0.71
R7342:Taf1b UTSW 12 24558344 nonsense probably null
R7449:Taf1b UTSW 12 24504993 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTTTAAAGCTGCTGCATCTACTG -3'
(R):5'- CATGCCAAAGTGTATGCCTG -3'

Sequencing Primer
(F):5'- TAAAGCTGCTGCATCTACTGGTGAG -3'
(R):5'- GCCAAAGTGTATGCCTGTTCAACAG -3'
Posted On2018-04-27