Incidental Mutation 'R6368:Rpl3'
ID512813
Institutional Source Beutler Lab
Gene Symbol Rpl3
Ensembl Gene ENSMUSG00000060036
Gene Nameribosomal protein L3
SynonymsJ1, F2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6368 (G1)
Quality Score201.009
Status Not validated
Chromosome15
Chromosomal Location80077791-80091868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80082544 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 14 (L14F)
Ref Sequence ENSEMBL: ENSMUSP00000139467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081650] [ENSMUST00000185306] [ENSMUST00000187832]
Predicted Effect probably damaging
Transcript: ENSMUST00000081650
AA Change: L14F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080354
Gene: ENSMUSG00000060036
AA Change: L14F

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.7e-194 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157594
Predicted Effect probably damaging
Transcript: ENSMUST00000185306
AA Change: L35F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140228
Gene: ENSMUSG00000060036
AA Change: L35F

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 71 188 6.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187578
Predicted Effect probably damaging
Transcript: ENSMUST00000187832
AA Change: L14F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139467
Gene: ENSMUSG00000060036
AA Change: L14F

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 50 157 2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199549
Predicted Effect probably benign
Transcript: ENSMUST00000230985
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the complexes that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L3P family of ribosomal proteins and it is located in the cytoplasm. The protein can bind to the HIV-1 TAR mRNA, and it has been suggested that the protein contributes to tat-mediated transactivation. This gene is co-transcribed with several small nucleolar RNA genes, which are located in several of this gene's introns. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Rpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Rpl3 APN 15 80079860 splice site probably benign
IGL03279:Rpl3 APN 15 80078359 missense probably benign 0.08
R1828:Rpl3 UTSW 15 80080390 missense possibly damaging 0.47
R6469:Rpl3 UTSW 15 80083345 unclassified probably null
R7657:Rpl3 UTSW 15 80081057 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCCAAGTTGGACAAGG -3'
(R):5'- AAAGTTCACCCATCGAGGTTTTAG -3'

Sequencing Primer
(F):5'- GAAGTACTGTACATACTAGATCCTGG -3'
(R):5'- CACCCATCGAGGTTTTAGTATAAC -3'
Posted On2018-04-27