Incidental Mutation 'R6368:Zfp148'
ID512817
Institutional Source Beutler Lab
Gene Symbol Zfp148
Ensembl Gene ENSMUSG00000022811
Gene Namezinc finger protein 148
SynonymsZBP-89, BFCOL1, BERF-1, beta enolase repressor factor 1, 2210405J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33380836-33504363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33497198 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 705 (Q705K)
Ref Sequence ENSEMBL: ENSMUSP00000156030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089677] [ENSMUST00000165418] [ENSMUST00000232023]
Predicted Effect probably damaging
Transcript: ENSMUST00000089677
AA Change: Q747K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087106
Gene: ENSMUSG00000022811
AA Change: Q747K

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165418
AA Change: Q747K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126338
Gene: ENSMUSG00000022811
AA Change: Q747K

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232023
AA Change: Q705K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel family of zinc finger DNA binding proteins. The encoded protein activates transcription of the T-cell receptor and intestinal alkaline phosphatase genes but represses transcription of the ornithine decarboxylase, vimentin, gastrin, stomelysin, and enolase genes. Increased expression of this gene results in decreased patient survival rates from colorectal cancer, while mutations in this gene have been associated with global developmental delay, hypoplastic corpus callosum, and dysmorphic facies. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption of one allele results in haploinsufficient male infertility in which chimeric males display a loss of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Zfp148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Zfp148 APN 16 33456943 missense probably benign
IGL02059:Zfp148 APN 16 33496563 missense probably damaging 1.00
IGL02389:Zfp148 APN 16 33495446 missense probably damaging 1.00
ANU22:Zfp148 UTSW 16 33456943 missense probably benign
R0680:Zfp148 UTSW 16 33495804 missense possibly damaging 0.74
R1455:Zfp148 UTSW 16 33495465 critical splice donor site probably null
R2175:Zfp148 UTSW 16 33496746 nonsense probably null
R2497:Zfp148 UTSW 16 33496385 missense probably damaging 1.00
R4229:Zfp148 UTSW 16 33434763 missense probably benign 0.00
R4470:Zfp148 UTSW 16 33496232 missense probably damaging 0.98
R4687:Zfp148 UTSW 16 33496819 missense probably damaging 1.00
R4693:Zfp148 UTSW 16 33468135 missense probably damaging 1.00
R4701:Zfp148 UTSW 16 33456908 missense probably benign 0.00
R5272:Zfp148 UTSW 16 33496224 missense probably damaging 0.99
R5479:Zfp148 UTSW 16 33497219 missense probably damaging 0.99
R5511:Zfp148 UTSW 16 33434634 start gained probably benign
R5679:Zfp148 UTSW 16 33495786 missense probably damaging 1.00
R5798:Zfp148 UTSW 16 33496143 missense probably benign 0.03
R6142:Zfp148 UTSW 16 33495459 missense possibly damaging 0.63
R6866:Zfp148 UTSW 16 33468126 missense probably damaging 1.00
R7347:Zfp148 UTSW 16 33434790 missense possibly damaging 0.86
R7419:Zfp148 UTSW 16 33497141 missense possibly damaging 0.87
R7709:Zfp148 UTSW 16 33468175 missense probably damaging 0.99
Z1177:Zfp148 UTSW 16 33496469 missense probably benign 0.10
Z1177:Zfp148 UTSW 16 33496799 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGTCGGTGACTCACAGCAC -3'
(R):5'- AGAGCAACCCCACTCTTGAG -3'

Sequencing Primer
(F):5'- GTTTCCCTTTTCAGGTGACGAGAC -3'
(R):5'- GATGTCATCCCAGCTCTA -3'
Posted On2018-04-27