Mutagenetix > Incidental Mutation

Incidental Mutation 'R6368:Vmn2r111'

512821

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R6368 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22571908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 136 (K136N)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: K136N

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: K136N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	C	A	9: 55,990,132	E272D	possibly damaging	Het
Abi2	A	G	1: 60,453,651	T158A	possibly damaging	Het
Acacb	T	C	5: 114,216,823	S1221P	probably damaging	Het
Agbl1	A	G	7: 76,419,830	D370G	probably benign	Het
Apeh	A	G	9: 108,087,243	I487T	probably damaging	Het
Arid1b	C	A	17: 5,332,533	N1297K	possibly damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atp7b	A	C	8: 22,020,755		probably null	Het
Bsn	C	T	9: 108,111,314		probably benign	Het
Caps2	C	T	10: 112,194,968	Q268*	probably null	Het
Cnfn	C	T	7: 25,367,961		probably null	Het
Cr2	A	G	1: 195,168,472	S229P	probably damaging	Het
Cubn	T	C	2: 13,430,995	Y1050C	probably damaging	Het
Cubn	T	C	2: 13,476,123	E307G	probably damaging	Het
Cyb5r3	A	C	15: 83,160,124	Y182D	possibly damaging	Het
Dclre1a	A	T	19: 56,546,791	H120Q	probably benign	Het
Ddx6	T	C	9: 44,635,776	I457T	probably damaging	Het
E2f1	A	T	2: 154,564,476	H93Q	possibly damaging	Het
Fam186a	T	C	15: 99,943,317	K1682R	possibly damaging	Het
Farsb	A	G	1: 78,466,965		probably null	Het
Flii	A	T	11: 60,721,136	L347Q	probably damaging	Het
Galntl6	T	G	8: 58,911,441	T12P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm21680	T	C	5: 25,969,036	N190S	probably damaging	Het
Ifit1bl2	T	C	19: 34,619,125	S364G	probably benign	Het
Kdm2a	A	G	19: 4,350,317	I234T	probably damaging	Het
Kdm5b	T	C	1: 134,599,207	C356R	probably damaging	Het
Kel	A	T	6: 41,688,851	C174*	probably null	Het
Krt16	T	A	11: 100,246,676	D401V	probably damaging	Het
Ltb4r1	A	C	14: 55,767,743	I168L	probably benign	Het
Luzp1	T	A	4: 136,541,780	M438K	probably benign	Het
Mtf1	C	T	4: 124,824,352	T281M	probably damaging	Het
Myo9a	T	A	9: 59,924,948	S2587T	probably benign	Het
Olfr1311	A	T	2: 112,021,551	I101N	probably damaging	Het
Olfr1377	T	A	11: 50,984,786	F28L	probably benign	Het
Olfr532	G	T	7: 140,419,667	Y35*	probably null	Het
Olfr860	T	C	9: 19,846,409	D70G	probably damaging	Het
Pcm1	T	A	8: 41,293,544	F1221Y	probably benign	Het
Pnldc1	A	T	17: 12,905,864	N90K	probably damaging	Het
Prickle2	A	T	6: 92,420,237	L169Q	probably damaging	Het
Ralgps2	A	T	1: 156,884,574	L147I	probably damaging	Het
Rfx3	A	T	19: 27,768,609	L674Q	possibly damaging	Het
Rpl3	C	A	15: 80,082,544	L14F	probably damaging	Het
Rrbp1	C	T	2: 143,989,555	G231R	probably damaging	Het
Sema3d	C	T	5: 12,571,013	L529F	probably damaging	Het
Slain1	A	T	14: 103,656,955	T193S	probably benign	Het
Slc2a6	G	T	2: 27,024,587	Q256K	possibly damaging	Het
Slk	A	G	19: 47,620,183	E525G	possibly damaging	Het
Spsb4	G	T	9: 96,944,645	Q252K	probably benign	Het
Taf1b	A	G	12: 24,558,257	T552A	possibly damaging	Het
Tmprss15	T	C	16: 79,006,057		probably null	Het
Tph2	T	C	10: 115,179,326	H177R	probably damaging	Het
Ttll1	A	G	15: 83,489,617	S332P	probably damaging	Het
Twf2	T	G	9: 106,212,833	N128K	probably benign	Het
Vegfc	T	A	8: 54,181,230	C315S	probably damaging	Het
Wnk2	T	C	13: 49,061,338	E496G	probably damaging	Het
Zfp148	C	A	16: 33,497,198	Q705K	probably damaging	Het
Zw10	C	T	9: 49,073,235	A539V	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTATGCCTAGCAAGGTCATGC -3'
(R):5'- TTACAGAACTCAGACTGAAAATCGC -3'

Sequencing Primer
(F):5'- TCATGCTGGCACAAGAGATAC -3'
(R):5'- CAAATATGCTCTGGCTTTGGC -3'

Posted On

2018-04-27