Incidental Mutation 'R6368:Kdm2a'
ID512822
Institutional Source Beutler Lab
Gene Symbol Kdm2a
Ensembl Gene ENSMUSG00000054611
Gene Namelysine (K)-specific demethylase 2A
SynonymsGm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4314419-4398285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4350317 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 234 (I234T)
Ref Sequence ENSEMBL: ENSMUSP00000139651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000116571] [ENSMUST00000175959]
Predicted Effect probably damaging
Transcript: ENSMUST00000047898
AA Change: I234T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: I234T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075856
AA Change: I234T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: I234T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116571
AA Change: I234T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139651
Gene: ENSMUSG00000054611
AA Change: I234T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 5.9e-37 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 493 4e-21 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175777
Predicted Effect probably benign
Transcript: ENSMUST00000175959
SMART Domains Protein: ENSMUSP00000135689
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
PDB:2YU2|A 1 206 1e-140 PDB
Blast:JmjC 7 79 8e-23 BLAST
Blast:JmjC 125 206 3e-55 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Kdm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdm2a APN 19 4356898 missense possibly damaging 0.94
IGL00679:Kdm2a APN 19 4326841 missense probably damaging 1.00
IGL01104:Kdm2a APN 19 4356738 splice site probably benign
IGL01161:Kdm2a APN 19 4319251 missense probably benign 0.04
IGL01433:Kdm2a APN 19 4342860 missense possibly damaging 0.83
IGL01456:Kdm2a APN 19 4351755 missense probably damaging 1.00
IGL01467:Kdm2a APN 19 4324407 missense probably damaging 0.99
IGL01517:Kdm2a APN 19 4362061 splice site probably benign
IGL01528:Kdm2a APN 19 4343055 missense probably benign 0.18
IGL02504:Kdm2a APN 19 4356771 missense possibly damaging 0.92
IGL02895:Kdm2a APN 19 4362902 missense probably damaging 1.00
IGL03109:Kdm2a APN 19 4329107 missense probably benign 0.04
IGL03171:Kdm2a APN 19 4356764 missense probably damaging 1.00
IGL03256:Kdm2a APN 19 4345510 unclassified probably benign
BB009:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
BB019:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
P0027:Kdm2a UTSW 19 4343245 splice site probably benign
PIT4382001:Kdm2a UTSW 19 4343173 missense probably benign
R0220:Kdm2a UTSW 19 4324919 missense possibly damaging 0.85
R0961:Kdm2a UTSW 19 4329191 missense probably benign 0.07
R1662:Kdm2a UTSW 19 4328212 missense probably damaging 1.00
R2023:Kdm2a UTSW 19 4322464 missense probably damaging 0.98
R2191:Kdm2a UTSW 19 4356931 splice site probably null
R2207:Kdm2a UTSW 19 4362870 missense probably damaging 1.00
R2351:Kdm2a UTSW 19 4329126 missense probably benign 0.02
R2406:Kdm2a UTSW 19 4322518 missense probably damaging 1.00
R2882:Kdm2a UTSW 19 4331184 critical splice donor site probably null
R3788:Kdm2a UTSW 19 4351805 missense probably damaging 0.99
R3792:Kdm2a UTSW 19 4324512 missense possibly damaging 0.91
R3950:Kdm2a UTSW 19 4343232 missense possibly damaging 0.89
R4235:Kdm2a UTSW 19 4322521 missense probably damaging 0.98
R4377:Kdm2a UTSW 19 4329054 missense probably benign 0.01
R4466:Kdm2a UTSW 19 4320300 missense probably damaging 0.99
R4766:Kdm2a UTSW 19 4324507 unclassified probably benign
R4824:Kdm2a UTSW 19 4362787 missense probably damaging 1.00
R4838:Kdm2a UTSW 19 4325026 missense probably benign 0.41
R5283:Kdm2a UTSW 19 4331269 missense probably benign 0.00
R6366:Kdm2a UTSW 19 4324932 missense probably benign 0.15
R6522:Kdm2a UTSW 19 4324826 missense possibly damaging 0.49
R6716:Kdm2a UTSW 19 4329102 missense probably damaging 1.00
R6757:Kdm2a UTSW 19 4319243 missense probably damaging 0.98
R6912:Kdm2a UTSW 19 4322501 missense probably benign 0.06
R6996:Kdm2a UTSW 19 4345641 missense probably benign 0.16
R7090:Kdm2a UTSW 19 4319141 missense probably damaging 1.00
R7497:Kdm2a UTSW 19 4324376 missense probably damaging 1.00
R7542:Kdm2a UTSW 19 4333830 start gained probably benign
R7932:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
R8199:Kdm2a UTSW 19 4389026 missense unknown
R8263:Kdm2a UTSW 19 4324364 missense possibly damaging 0.88
RF046:Kdm2a UTSW 19 4324507 unclassified probably benign
X0028:Kdm2a UTSW 19 4320271 missense possibly damaging 0.77
X0028:Kdm2a UTSW 19 4348746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCCTTGTTCATAATCGGC -3'
(R):5'- AATCTAGATGCTGTCAGACCAAG -3'

Sequencing Primer
(F):5'- GGCATTGTTTAAGAAACTTAGAAAGC -3'
(R):5'- CTAGATGCTGTCAGACCAAGTGATTG -3'
Posted On2018-04-27