Incidental Mutation 'R6369:Asb18'
ID512829
Institutional Source Beutler Lab
Gene Symbol Asb18
Ensembl Gene ENSMUSG00000067081
Gene Nameankyrin repeat and SOCS box-containing 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location89950220-90014666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90014471 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 36 (I36N)
Ref Sequence ENSEMBL: ENSMUSP00000117767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086882] [ENSMUST00000097656] [ENSMUST00000151330] [ENSMUST00000154228]
Predicted Effect probably damaging
Transcript: ENSMUST00000086882
AA Change: I36N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084095
Gene: ENSMUSG00000067081
AA Change: I36N

DomainStartEndE-ValueType
Blast:ANK 15 44 3e-8 BLAST
ANK 119 148 5.32e-5 SMART
ANK 151 180 1.99e-4 SMART
ANK 184 213 3.26e2 SMART
ANK 218 247 3.95e1 SMART
ANK 251 289 1.96e3 SMART
ANK 293 322 6.61e-1 SMART
Blast:ANK 329 365 1e-12 BLAST
SOCS_box 422 461 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097656
AA Change: I36N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095261
Gene: ENSMUSG00000067081
AA Change: I36N

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-8 BLAST
SOCS_box 158 197 4.5e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151330
AA Change: I36N

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117836
Gene: ENSMUSG00000067081
AA Change: I36N

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154228
AA Change: I36N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117767
Gene: ENSMUSG00000067081
AA Change: I36N

DomainStartEndE-ValueType
Blast:ANK 15 44 9e-9 BLAST
ANK 78 107 5.32e-5 SMART
ANK 110 139 1.99e-4 SMART
Meta Mutation Damage Score 0.3668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Asb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Asb18 APN 1 89996241 missense probably benign 0.02
IGL01559:Asb18 APN 1 89954450 missense probably damaging 1.00
IGL02188:Asb18 APN 1 89996299 missense probably benign 0.08
IGL02378:Asb18 APN 1 89992988 missense probably damaging 1.00
IGL02543:Asb18 APN 1 90014391 missense probably damaging 0.99
IGL02828:Asb18 APN 1 89996210 critical splice donor site probably null
IGL02877:Asb18 APN 1 89952811 missense possibly damaging 0.65
IGL03290:Asb18 APN 1 90014574 missense probably damaging 1.00
R0560:Asb18 UTSW 1 90014528 missense probably damaging 1.00
R0671:Asb18 UTSW 1 89993171 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1510:Asb18 UTSW 1 89996254 missense possibly damaging 0.62
R1721:Asb18 UTSW 1 89968580 missense probably benign 0.36
R1793:Asb18 UTSW 1 90014555 missense probably damaging 1.00
R1863:Asb18 UTSW 1 90014382 missense probably benign 0.10
R2171:Asb18 UTSW 1 89968697 missense probably benign 0.01
R2348:Asb18 UTSW 1 90014534 missense probably damaging 0.99
R3052:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3053:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3427:Asb18 UTSW 1 89968593 missense probably damaging 0.99
R4094:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4105:Asb18 UTSW 1 89968521 missense possibly damaging 0.61
R4405:Asb18 UTSW 1 89968689 missense probably benign 0.00
R4815:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4992:Asb18 UTSW 1 89952863 missense probably benign 0.03
R5287:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5403:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5494:Asb18 UTSW 1 89954399 missense probably damaging 1.00
R5504:Asb18 UTSW 1 89993024 missense probably damaging 1.00
R5617:Asb18 UTSW 1 89954462 missense possibly damaging 0.90
R5826:Asb18 UTSW 1 90014538 missense probably damaging 0.97
R7474:Asb18 UTSW 1 89993033 missense possibly damaging 0.91
R7751:Asb18 UTSW 1 89968484 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGTCACCCTGTTGGAACCC -3'
(R):5'- AGCCCTGATTCTATTTATAGCCATCTG -3'

Sequencing Primer
(F):5'- GTTGGAACCCTTGCCCCTG -3'
(R):5'- CATCTGTCCTGCTCTGGGG -3'
Posted On2018-04-27