Incidental Mutation 'R6369:Serpinb3d'
ID 512830
Institutional Source Beutler Lab
Gene Symbol Serpinb3d
Ensembl Gene ENSMUSG00000058017
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Synonyms
MMRRC Submission 044519-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6369 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 107078167-107083506 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 107080753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 127 (N127K)
Ref Sequence ENSEMBL: ENSMUSP00000023861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023861]
AlphaFold Q6UKZ0
Predicted Effect probably benign
Transcript: ENSMUST00000023861
AA Change: N127K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023861
Gene: ENSMUSG00000058017
AA Change: N127K

DomainStartEndE-ValueType
SERPIN 13 387 2.44e-169 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 (GRCm38) R571* probably null Het
Asb18 A T 1: 90,014,471 (GRCm38) I36N probably damaging Het
Ascc3 G A 10: 50,699,985 (GRCm38) G779S probably damaging Het
Atl2 T C 17: 79,854,555 (GRCm38) Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 (GRCm38) I235T probably damaging Het
Bri3bp A G 5: 125,454,701 (GRCm38) N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 (GRCm38) N256S probably benign Het
Cchcr1 T C 17: 35,528,176 (GRCm38) I474T probably damaging Het
Cd209c T C 8: 3,944,984 (GRCm38) Y60C probably damaging Het
Cd300c C A 11: 114,957,555 (GRCm38) D171Y probably damaging Het
Crb1 C T 1: 139,237,462 (GRCm38) V975M probably damaging Het
Csmd1 C T 8: 17,535,004 (GRCm38) probably benign Het
Ctnna2 A G 6: 76,980,695 (GRCm38) S524P possibly damaging Het
Eno1 T C 4: 150,239,568 (GRCm38) probably null Het
Ero1a T C 14: 45,299,958 (GRCm38) I170M probably damaging Het
Fam186a A G 15: 99,947,331 (GRCm38) M344T unknown Het
Frem1 A T 4: 82,913,792 (GRCm38) probably null Het
Gjb5 G T 4: 127,355,930 (GRCm38) D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 (GRCm38) R100C unknown Het
Hk2 G T 6: 82,736,753 (GRCm38) S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 (GRCm38) I322F probably benign Het
Itga1 T C 13: 114,965,660 (GRCm38) I1145V probably damaging Het
Kcp A G 6: 29,484,694 (GRCm38) L1295S probably damaging Het
Macf1 T C 4: 123,410,562 (GRCm38) D49G possibly damaging Het
Mef2b T A 8: 70,165,559 (GRCm38) D96E probably benign Het
Megf10 A T 18: 57,261,187 (GRCm38) D461V probably benign Het
Myom1 T C 17: 71,101,076 (GRCm38) S1104P probably damaging Het
Nab1 A G 1: 52,490,222 (GRCm38) L172P probably damaging Het
Or2g1 T G 17: 37,795,496 (GRCm38) D17E probably benign Het
Pate1 A G 9: 35,687,028 (GRCm38) V18A probably benign Het
Pink1 T C 4: 138,320,734 (GRCm38) probably null Het
Pnpla1 T A 17: 28,878,481 (GRCm38) I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 (GRCm38) E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 (GRCm38) probably null Het
Rad52 A G 6: 119,914,207 (GRCm38) E76G unknown Het
Rad54l A G 4: 116,111,189 (GRCm38) probably null Het
Rasgrf2 T C 13: 92,131,446 (GRCm38) M17V probably benign Het
Rbm42 A G 7: 30,641,313 (GRCm38) M411T unknown Het
Reln A G 5: 22,051,361 (GRCm38) I495T probably benign Het
Rnf224 A G 2: 25,235,942 (GRCm38) F133S probably damaging Het
Rrm1 C A 7: 102,446,702 (GRCm38) H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 (GRCm38) D235G possibly damaging Het
Skint7 A T 4: 111,980,293 (GRCm38) E89D probably benign Het
Slc22a5 T G 11: 53,891,370 (GRCm38) N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 (GRCm38) F263I probably damaging Het
Sncaip A G 18: 52,868,604 (GRCm38) I66V probably damaging Het
Syngr1 A C 15: 80,115,590 (GRCm38) probably benign Het
Tbc1d2 A G 4: 46,614,420 (GRCm38) Y554H probably benign Het
Tmem198 T C 1: 75,479,743 (GRCm38) V44A probably benign Het
Trappc11 T C 8: 47,512,285 (GRCm38) probably null Het
Uox C T 3: 146,624,577 (GRCm38) R163* probably null Het
Vmn2r111 C T 17: 22,548,602 (GRCm38) C638Y probably damaging Het
Washc4 A G 10: 83,574,444 (GRCm38) Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 (GRCm38) V270A probably benign Het
Zfp92 G A X: 73,421,968 (GRCm38) R189H possibly damaging Homo
Other mutations in Serpinb3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Serpinb3d APN 1 107,079,666 (GRCm38) missense probably damaging 1.00
IGL01917:Serpinb3d APN 1 107,079,681 (GRCm38) missense probably damaging 1.00
IGL02732:Serpinb3d APN 1 107,082,796 (GRCm38) critical splice acceptor site probably null
IGL02988:Serpinb3d UTSW 1 107,078,536 (GRCm38) missense probably benign
R0540:Serpinb3d UTSW 1 107,079,232 (GRCm38) missense probably benign 0.01
R0594:Serpinb3d UTSW 1 107,079,347 (GRCm38) missense probably damaging 1.00
R1666:Serpinb3d UTSW 1 107,080,751 (GRCm38) missense probably benign 0.18
R1668:Serpinb3d UTSW 1 107,080,751 (GRCm38) missense probably benign 0.18
R1905:Serpinb3d UTSW 1 107,079,284 (GRCm38) missense possibly damaging 0.71
R1994:Serpinb3d UTSW 1 107,080,788 (GRCm38) missense possibly damaging 0.52
R2021:Serpinb3d UTSW 1 107,078,452 (GRCm38) missense probably benign 0.05
R2022:Serpinb3d UTSW 1 107,078,452 (GRCm38) missense probably benign 0.05
R3760:Serpinb3d UTSW 1 107,081,574 (GRCm38) splice site probably benign
R4118:Serpinb3d UTSW 1 107,079,230 (GRCm38) missense possibly damaging 0.58
R4496:Serpinb3d UTSW 1 107,079,292 (GRCm38) missense probably damaging 0.98
R4770:Serpinb3d UTSW 1 107,078,278 (GRCm38) missense probably damaging 1.00
R4793:Serpinb3d UTSW 1 107,078,221 (GRCm38) missense probably damaging 1.00
R5174:Serpinb3d UTSW 1 107,078,498 (GRCm38) missense possibly damaging 0.63
R5434:Serpinb3d UTSW 1 107,078,533 (GRCm38) missense probably benign 0.02
R5813:Serpinb3d UTSW 1 107,079,297 (GRCm38) missense probably benign 0.14
R5820:Serpinb3d UTSW 1 107,078,359 (GRCm38) missense probably damaging 0.99
R5935:Serpinb3d UTSW 1 107,083,375 (GRCm38) missense probably benign 0.00
R6056:Serpinb3d UTSW 1 107,079,722 (GRCm38) missense probably damaging 1.00
R6092:Serpinb3d UTSW 1 107,079,259 (GRCm38) missense probably damaging 1.00
R6188:Serpinb3d UTSW 1 107,078,507 (GRCm38) missense probably damaging 0.98
R6247:Serpinb3d UTSW 1 107,082,760 (GRCm38) missense probably benign 0.01
R6476:Serpinb3d UTSW 1 107,083,341 (GRCm38) missense probably benign 0.09
R7178:Serpinb3d UTSW 1 107,080,776 (GRCm38) missense possibly damaging 0.72
R7743:Serpinb3d UTSW 1 107,079,358 (GRCm38) missense probably damaging 0.99
R7765:Serpinb3d UTSW 1 107,079,782 (GRCm38) missense probably damaging 1.00
R8371:Serpinb3d UTSW 1 107,080,739 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACTGATTGGCTTTCTGTAAAC -3'
(R):5'- AACCTTACACAAGCCTTCACTTTG -3'

Sequencing Primer
(F):5'- ACTGATTGGCTTTCTGTAAACTTCTC -3'
(R):5'- TACCTGAGTGAAAAATCTGCATG -3'
Posted On 2018-04-27