Incidental Mutation 'R6369:Serpinb3d'
List |< first << previous [record 43 of 56] next >> last >|
ID512830
Institutional Source Beutler Lab
Gene Symbol Serpinb3d
Ensembl Gene ENSMUSG00000058017
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107078167-107083506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107080753 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 127 (N127K)
Ref Sequence ENSEMBL: ENSMUSP00000023861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023861]
Predicted Effect probably benign
Transcript: ENSMUST00000023861
AA Change: N127K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023861
Gene: ENSMUSG00000058017
AA Change: N127K

DomainStartEndE-ValueType
SERPIN 13 387 2.44e-169 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Serpinb3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Serpinb3d APN 1 107079666 missense probably damaging 1.00
IGL01917:Serpinb3d APN 1 107079681 missense probably damaging 1.00
IGL02732:Serpinb3d APN 1 107082796 critical splice acceptor site probably null
IGL02988:Serpinb3d UTSW 1 107078536 missense probably benign
R0540:Serpinb3d UTSW 1 107079232 missense probably benign 0.01
R0594:Serpinb3d UTSW 1 107079347 missense probably damaging 1.00
R1666:Serpinb3d UTSW 1 107080751 missense probably benign 0.18
R1668:Serpinb3d UTSW 1 107080751 missense probably benign 0.18
R1905:Serpinb3d UTSW 1 107079284 missense possibly damaging 0.71
R1994:Serpinb3d UTSW 1 107080788 missense possibly damaging 0.52
R2021:Serpinb3d UTSW 1 107078452 missense probably benign 0.05
R2022:Serpinb3d UTSW 1 107078452 missense probably benign 0.05
R3760:Serpinb3d UTSW 1 107081574 splice site probably benign
R4118:Serpinb3d UTSW 1 107079230 missense possibly damaging 0.58
R4496:Serpinb3d UTSW 1 107079292 missense probably damaging 0.98
R4770:Serpinb3d UTSW 1 107078278 missense probably damaging 1.00
R4793:Serpinb3d UTSW 1 107078221 missense probably damaging 1.00
R5174:Serpinb3d UTSW 1 107078498 missense possibly damaging 0.63
R5434:Serpinb3d UTSW 1 107078533 missense probably benign 0.02
R5813:Serpinb3d UTSW 1 107079297 missense probably benign 0.14
R5820:Serpinb3d UTSW 1 107078359 missense probably damaging 0.99
R5935:Serpinb3d UTSW 1 107083375 missense probably benign 0.00
R6056:Serpinb3d UTSW 1 107079722 missense probably damaging 1.00
R6092:Serpinb3d UTSW 1 107079259 missense probably damaging 1.00
R6188:Serpinb3d UTSW 1 107078507 missense probably damaging 0.98
R6247:Serpinb3d UTSW 1 107082760 missense probably benign 0.01
R6476:Serpinb3d UTSW 1 107083341 missense probably benign 0.09
R7178:Serpinb3d UTSW 1 107080776 missense possibly damaging 0.72
R7743:Serpinb3d UTSW 1 107079358 missense probably damaging 0.99
R7765:Serpinb3d UTSW 1 107079782 missense probably damaging 1.00
R8371:Serpinb3d UTSW 1 107080739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACTGATTGGCTTTCTGTAAAC -3'
(R):5'- AACCTTACACAAGCCTTCACTTTG -3'

Sequencing Primer
(F):5'- ACTGATTGGCTTTCTGTAAACTTCTC -3'
(R):5'- TACCTGAGTGAAAAATCTGCATG -3'
Posted On2018-04-27