Incidental Mutation 'R6369:Pink1'
ID512842
Institutional Source Beutler Lab
Gene Symbol Pink1
Ensembl Gene ENSMUSG00000028756
Gene NamePTEN induced putative kinase 1
Synonyms1190006F07Rik, brpk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6369 (G1)
Quality Score208.009
Status Validated
Chromosome4
Chromosomal Location138313409-138326307 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 138320734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030536] [ENSMUST00000105816] [ENSMUST00000105817]
Predicted Effect probably null
Transcript: ENSMUST00000030536
SMART Domains Protein: ENSMUSP00000030536
Gene: ENSMUSG00000028756

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 30 43 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 105 110 N/A INTRINSIC
Pfam:Pkinase 257 508 2.9e-24 PFAM
Pfam:Pkinase_Tyr 306 506 4e-15 PFAM
low complexity region 558 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105816
SMART Domains Protein: ENSMUSP00000101442
Gene: ENSMUSG00000028756

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 94 4.6e-6 PFAM
Pfam:Pkinase 1 96 8.4e-9 PFAM
low complexity region 146 161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105817
SMART Domains Protein: ENSMUSP00000101443
Gene: ENSMUSG00000028756

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 75 80 N/A INTRINSIC
Pfam:Pkinase 231 478 7.9e-29 PFAM
Pfam:Pkinase_Tyr 276 476 1.2e-15 PFAM
low complexity region 528 543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183998
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that localizes to mitochondria. It is thought to protect cells from stress-induced mitochondrial dysfunction. Mutations in this gene cause one form of autosomal recessive early-onset Parkinson disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some mice homozygous for null mutations exhibit decreased dopamine content, reduced long term potentional and depression, mitochondrial abnormalities, and/or behavioral abnormalities. Some null mice model the early stages of Parkinson Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Pink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Pink1 APN 4 138320097 splice site probably null
IGL01998:Pink1 APN 4 138320742 missense probably damaging 1.00
R0013:Pink1 UTSW 4 138317401 missense probably benign 0.00
R0092:Pink1 UTSW 4 138319998 missense probably benign 0.00
R0183:Pink1 UTSW 4 138314179 missense probably damaging 1.00
R0400:Pink1 UTSW 4 138317918 missense probably damaging 1.00
R0637:Pink1 UTSW 4 138318046 missense probably damaging 1.00
R1808:Pink1 UTSW 4 138317319 missense probably damaging 1.00
R1876:Pink1 UTSW 4 138315702 missense probably damaging 1.00
R1918:Pink1 UTSW 4 138314020 missense probably benign 0.31
R1919:Pink1 UTSW 4 138314020 missense probably benign 0.31
R2012:Pink1 UTSW 4 138318005 missense probably null 0.05
R2034:Pink1 UTSW 4 138318032 missense possibly damaging 0.88
R4120:Pink1 UTSW 4 138315511 nonsense probably null
R4613:Pink1 UTSW 4 138317310 missense probably damaging 1.00
R4913:Pink1 UTSW 4 138315555 nonsense probably null
R5830:Pink1 UTSW 4 138316014 start codon destroyed probably null 1.00
R7090:Pink1 UTSW 4 138315601 missense probably damaging 0.99
R7136:Pink1 UTSW 4 138317458 missense probably damaging 1.00
R7644:Pink1 UTSW 4 138317372 missense probably damaging 1.00
R8307:Pink1 UTSW 4 138317962 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCACAGAACAGAAGCCTGGG -3'
(R):5'- CCGTCTGGAGGATTATCTGATAGG -3'

Sequencing Primer
(F):5'- GCGGCACCATCAGAACTTG -3'
(R):5'- TATCTGATAGGGCAAGCCATTG -3'
Posted On2018-04-27