Incidental Mutation 'R6369:Eno1'
ID512843
Institutional Source Beutler Lab
Gene Symbol Eno1
Ensembl Gene ENSMUSG00000063524
Gene Nameenolase 1, alpha non-neuron
Synonymsalpha-enolase, 2-phospho-D-glycerate hydrolase, Eno-1, MBP-1, c-Myc promoter binding protein
MMRRC Submission
Accession Numbers

Genbank: NM_023119

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150236721-150248879 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 150239568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080149] [ENSMUST00000080926] [ENSMUST00000133839] [ENSMUST00000141931] [ENSMUST00000150175]
Predicted Effect probably benign
Transcript: ENSMUST00000080149
SMART Domains Protein: ENSMUSP00000079045
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 1 66 2.91e-6 SMART
Enolase_C 74 363 1.22e-207 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080926
SMART Domains Protein: ENSMUSP00000079727
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 134 4.75e-91 SMART
Enolase_C 142 431 1.22e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130632
Predicted Effect probably null
Transcript: ENSMUST00000133839
SMART Domains Protein: ENSMUSP00000114361
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 134 7.66e-86 SMART
Enolase_C 142 221 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135063
Predicted Effect probably null
Transcript: ENSMUST00000141931
SMART Domains Protein: ENSMUSP00000120059
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 67 6.31e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148605
Predicted Effect probably null
Transcript: ENSMUST00000150175
SMART Domains Protein: ENSMUSP00000123695
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 119 2.31e-71 SMART
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous animals exhibit growth arrest and embryonic lethality at approximately E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Eno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Eno1 APN 4 150246710 missense probably benign 0.03
IGL01992:Eno1 APN 4 150239536 missense probably damaging 1.00
IGL03114:Eno1 APN 4 150241126 missense probably benign 0.01
IGL03133:Eno1 APN 4 150245344 unclassified probably benign
B5639:Eno1 UTSW 4 150245112 unclassified probably benign
R1387:Eno1 UTSW 4 150248133 unclassified probably benign
R1957:Eno1 UTSW 4 150246775 unclassified probably null
R3835:Eno1 UTSW 4 150246662 missense probably benign 0.08
R3925:Eno1 UTSW 4 150239568 critical splice donor site probably null
R4178:Eno1 UTSW 4 150244033 missense possibly damaging 0.94
R5577:Eno1 UTSW 4 150246610 nonsense probably null
R5790:Eno1 UTSW 4 150245253 missense probably benign 0.01
R6377:Eno1 UTSW 4 150248552 missense possibly damaging 0.78
R7305:Eno1 UTSW 4 150245339 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCATTTGGTACCTGTCAAGTC -3'
(R):5'- TGAATTTGGAACTTGCCCTCC -3'

Sequencing Primer
(F):5'- TGTCAAGTCCAGGACCCCTC -3'
(R):5'- GAATTTGGAACTTGCCCTCCCTTAC -3'
Posted On2018-04-27