Incidental Mutation 'R6369:Smarcd3'
ID512845
Institutional Source Beutler Lab
Gene Symbol Smarcd3
Ensembl Gene ENSMUSG00000028949
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3
SynonymsBAF60C, 1500001J14Rik, 2210409C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24590818-24624411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24594984 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 263 (F263I)
Ref Sequence ENSEMBL: ENSMUSP00000030791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably damaging
Transcript: ENSMUST00000030791
AA Change: F263I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949
AA Change: F263I

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088295
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably benign
Transcript: ENSMUST00000121863
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147857
Predicted Effect possibly damaging
Transcript: ENSMUST00000195943
AA Change: F234I

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949
AA Change: F234I

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Smarcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Smarcd3 APN 5 24593719 missense probably damaging 1.00
R0135:Smarcd3 UTSW 5 24595499 unclassified probably benign
R1614:Smarcd3 UTSW 5 24594876 missense possibly damaging 0.93
R1617:Smarcd3 UTSW 5 24595194 missense probably damaging 1.00
R1753:Smarcd3 UTSW 5 24595822 nonsense probably null
R1879:Smarcd3 UTSW 5 24593021 missense probably damaging 0.99
R2307:Smarcd3 UTSW 5 24595748 missense probably damaging 1.00
R3800:Smarcd3 UTSW 5 24593227 nonsense probably null
R4592:Smarcd3 UTSW 5 24592804 missense probably benign 0.00
R6388:Smarcd3 UTSW 5 24596026 missense possibly damaging 0.94
R7077:Smarcd3 UTSW 5 24594962 missense probably damaging 1.00
R7078:Smarcd3 UTSW 5 24593069 missense probably damaging 0.98
R7341:Smarcd3 UTSW 5 24595437 missense possibly damaging 0.95
R7426:Smarcd3 UTSW 5 24595812 missense probably benign 0.30
R7806:Smarcd3 UTSW 5 24593262 missense probably benign 0.45
RF007:Smarcd3 UTSW 5 24596070 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTAAGGACATCCGTTACCTG -3'
(R):5'- TGGGTTCCAAGTGAAGAGAC -3'

Sequencing Primer
(F):5'- ACCTGCTGGAAATACTTGTCG -3'
(R):5'- TGCTCCTGATGCTGGACTATCAG -3'
Posted On2018-04-27