Mutagenetix > Incidental Mutation

Incidental Mutation 'R6369:Kcp'

512847

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, KCP, LOC333088

MMRRC Submission

044519-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R6369 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29473162-29507952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29484694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1295 (L1295S)

Ref Sequence

ENSEMBL: ENSMUSP00000099135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]

AlphaFold

Q3U492

Predicted Effect

probably benign
Transcript: ENSMUST00000078112

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091391

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000101614
AA Change: L1295S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: L1295S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158018

Predicted Effect

probably benign
Transcript: ENSMUST00000159479

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159482

Predicted Effect

probably benign
Transcript: ENSMUST00000161276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161655

Meta Mutation Damage Score

0.1877

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	C	T	17: 13,835,343	R571*	probably null	Het
Asb18	A	T	1: 90,014,471	I36N	probably damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atl2	T	C	17: 79,854,555	Q205R	probably damaging	Het
Axdnd1	A	G	1: 156,392,745	I235T	probably damaging	Het
Bri3bp	A	G	5: 125,454,701	N237S	probably damaging	Het
Ccdc191	A	G	16: 43,915,485	N256S	probably benign	Het
Cchcr1	T	C	17: 35,528,176	I474T	probably damaging	Het
Cd209c	T	C	8: 3,944,984	Y60C	probably damaging	Het
Cd300c	C	A	11: 114,957,555	D171Y	probably damaging	Het
Crb1	C	T	1: 139,237,462	V975M	probably damaging	Het
Csmd1	C	T	8: 17,535,004		probably benign	Het
Ctnna2	A	G	6: 76,980,695	S524P	possibly damaging	Het
Eno1	T	C	4: 150,239,568		probably null	Het
Ero1l	T	C	14: 45,299,958	I170M	probably damaging	Het
Fam186a	A	G	15: 99,947,331	M344T	unknown	Het
Frem1	A	T	4: 82,913,792		probably null	Het
Gjb5	G	T	4: 127,355,930	D140E	possibly damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Hk2	G	T	6: 82,736,753	S449R	probably damaging	Het
Hs3st3a1	A	T	11: 64,520,601	I322F	probably benign	Het
Itga1	T	C	13: 114,965,660	I1145V	probably damaging	Het
Macf1	T	C	4: 123,410,562	D49G	possibly damaging	Het
Mef2b	T	A	8: 70,165,559	D96E	probably benign	Het
Megf10	A	T	18: 57,261,187	D461V	probably benign	Het
Myom1	T	C	17: 71,101,076	S1104P	probably damaging	Het
Nab1	A	G	1: 52,490,222	L172P	probably damaging	Het
Olfr123	T	G	17: 37,795,496	D17E	probably benign	Het
Pate1	A	G	9: 35,687,028	V18A	probably benign	Het
Pink1	T	C	4: 138,320,734		probably null	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Ppp1r21	C	A	17: 88,582,412		probably null	Het
Rad52	A	G	6: 119,914,207	E76G	unknown	Het
Rad54l	A	G	4: 116,111,189		probably null	Het
Rasgrf2	T	C	13: 92,131,446	M17V	probably benign	Het
Rbm42	A	G	7: 30,641,313	M411T	unknown	Het
Reln	A	G	5: 22,051,361	I495T	probably benign	Het
Rnf224	A	G	2: 25,235,942	F133S	probably damaging	Het
Rrm1	C	A	7: 102,446,702	H87Q	probably damaging	Het
Sec14l2	T	C	11: 4,103,962	D235G	possibly damaging	Het
Serpinb3d	G	T	1: 107,080,753	N127K	probably benign	Het
Skint7	A	T	4: 111,980,293	E89D	probably benign	Het
Slc22a5	T	G	11: 53,891,370	N57T	probably damaging	Het
Smarcd3	A	T	5: 24,594,984	F263I	probably damaging	Het
Sncaip	A	G	18: 52,868,604	I66V	probably damaging	Het
Syngr1	A	C	15: 80,115,590		probably benign	Het
Tbc1d2	A	G	4: 46,614,420	Y554H	probably benign	Het
Tmem198	T	C	1: 75,479,743	V44A	probably benign	Het
Trappc11	T	C	8: 47,512,285		probably null	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r111	C	T	17: 22,548,602	C638Y	probably damaging	Het
Washc4	A	G	10: 83,574,444	Y632C	probably damaging	Het
Zfp212	T	C	6: 47,930,897	V270A	probably benign	Het
Zfp92	G	A	X: 73,421,968	R189H	possibly damaging	Homo

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29482657	missense	probably benign
IGL01344:Kcp	APN	6	29498951	splice site	probably null
IGL01404:Kcp	APN	6	29496639	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29498879	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29497908	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29489032	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29504549	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29484999	unclassified	probably benign
IGL02817:Kcp	APN	6	29496969	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29496631	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29498348	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29495785	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29496927	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29490439	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29485423	missense	probably benign
R1304:Kcp	UTSW	6	29501292	unclassified	probably benign
R1663:Kcp	UTSW	6	29498965	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29505655	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29497835	unclassified	probably benign
R2030:Kcp	UTSW	6	29489072	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29496165	nonsense	probably null
R3411:Kcp	UTSW	6	29482846	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29482258	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29493203	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29491848	nonsense	probably null
R4624:Kcp	UTSW	6	29482814	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29493197	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29484626	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29497629	nonsense	probably null
R5053:Kcp	UTSW	6	29496958	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29492108	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29498520	unclassified	probably benign
R5418:Kcp	UTSW	6	29504284	nonsense	probably null
R6020:Kcp	UTSW	6	29502864	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29502632	missense	probably benign
R6178:Kcp	UTSW	6	29482888	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29502365	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29493258	missense	probably damaging	0.98
R6860:Kcp	UTSW	6	29505720	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29484612	splice site	probably null
R6962:Kcp	UTSW	6	29482840	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29499170	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29491862	nonsense	probably null
R7141:Kcp	UTSW	6	29487512	nonsense	probably null
R7153:Kcp	UTSW	6	29499015	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29497200	splice site	probably null
R7334:Kcp	UTSW	6	29485512	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29499187	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29496517	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29496847	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29497765	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29482751	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29496619	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29489152	missense	probably benign
R9553:Kcp	UTSW	6	29485101	missense	probably null	1.00
R9752:Kcp	UTSW	6	29497755	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29492461	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29485012	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29485525	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TCAGAACACCTTGACTGCCTC -3'
(R):5'- TAGCAGTGCTGTTGGGAACC -3'

Sequencing Primer
(F):5'- AACACCTTGACTGCCTCCTGATC -3'
(R):5'- AACCGTGGCTGTGAGGCTG -3'

Posted On

2018-04-27