Incidental Mutation 'R6369:Zfp212'
ID 512848
Institutional Source Beutler Lab
Gene Symbol Zfp212
Ensembl Gene ENSMUSG00000052763
Gene Name Zinc finger protein 212
Synonyms Znf212
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R6369 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 47920476-47932639 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47930897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 270 (V270A)
Ref Sequence ENSEMBL: ENSMUSP00000009411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009411]
AlphaFold G3X8R7
Predicted Effect probably benign
Transcript: ENSMUST00000009411
AA Change: V270A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000009411
Gene: ENSMUSG00000052763
AA Change: V270A

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
Pfam:DUF3669 41 111 8.1e-10 PFAM
KRAB 141 202 6.08e-5 SMART
ZnF_C2H2 313 335 4.54e-4 SMART
ZnF_C2H2 366 388 6.57e-1 SMART
ZnF_C2H2 424 446 3.21e-4 SMART
ZnF_C2H2 452 474 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156500
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Zfp212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Zfp212 APN 6 47931322 missense probably damaging 0.98
IGL03357:Zfp212 APN 6 47930837 missense probably benign 0.28
R0122:Zfp212 UTSW 6 47931023 missense possibly damaging 0.87
R0219:Zfp212 UTSW 6 47926685 missense probably damaging 1.00
R0278:Zfp212 UTSW 6 47926519 missense probably damaging 1.00
R1845:Zfp212 UTSW 6 47931541 missense probably benign
R4910:Zfp212 UTSW 6 47931499 missense possibly damaging 0.94
R4991:Zfp212 UTSW 6 47926862 missense probably damaging 1.00
R5297:Zfp212 UTSW 6 47929077 missense probably benign
R6074:Zfp212 UTSW 6 47927052 nonsense probably null
R7275:Zfp212 UTSW 6 47920744 missense probably benign
R7873:Zfp212 UTSW 6 47930926 nonsense probably null
R9240:Zfp212 UTSW 6 47929098 missense probably benign 0.32
Z1176:Zfp212 UTSW 6 47926768 missense probably benign 0.12
Z1177:Zfp212 UTSW 6 47926520 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTCAAACAGGAGATGCTG -3'
(R):5'- GTTCTGTGGCAGAGTAAGACTCC -3'

Sequencing Primer
(F):5'- CTGTACAAGCAGGAAGGCCC -3'
(R):5'- GCGTGGCTCTGCAAATG -3'
Posted On 2018-04-27