Incidental Mutation 'R6369:Zfp212'
ID 512848
Institutional Source Beutler Lab
Gene Symbol Zfp212
Ensembl Gene ENSMUSG00000052763
Gene Name Zinc finger protein 212
Synonyms Znf212
MMRRC Submission 044519-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R6369 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 47897502-47909573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47907831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 270 (V270A)
Ref Sequence ENSEMBL: ENSMUSP00000009411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009411]
AlphaFold G3X8R7
Predicted Effect probably benign
Transcript: ENSMUST00000009411
AA Change: V270A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000009411
Gene: ENSMUSG00000052763
AA Change: V270A

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
Pfam:DUF3669 41 111 8.1e-10 PFAM
KRAB 141 202 6.08e-5 SMART
ZnF_C2H2 313 335 4.54e-4 SMART
ZnF_C2H2 366 388 6.57e-1 SMART
ZnF_C2H2 424 446 3.21e-4 SMART
ZnF_C2H2 452 474 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156500
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 14,055,605 (GRCm39) R571* probably null Het
Asb18 A T 1: 89,942,193 (GRCm39) I36N probably damaging Het
Ascc3 G A 10: 50,576,081 (GRCm39) G779S probably damaging Het
Atl2 T C 17: 80,161,984 (GRCm39) Q205R probably damaging Het
Axdnd1 A G 1: 156,220,315 (GRCm39) I235T probably damaging Het
Bri3bp A G 5: 125,531,765 (GRCm39) N237S probably damaging Het
Ccdc191 A G 16: 43,735,848 (GRCm39) N256S probably benign Het
Cchcr1 T C 17: 35,839,073 (GRCm39) I474T probably damaging Het
Cd209c T C 8: 3,994,984 (GRCm39) Y60C probably damaging Het
Cd300c C A 11: 114,848,381 (GRCm39) D171Y probably damaging Het
Crb1 C T 1: 139,165,200 (GRCm39) V975M probably damaging Het
Csmd1 C T 8: 17,585,020 (GRCm39) probably benign Het
Ctnna2 A G 6: 76,957,678 (GRCm39) S524P possibly damaging Het
Eno1 T C 4: 150,324,025 (GRCm39) probably null Het
Ero1a T C 14: 45,537,415 (GRCm39) I170M probably damaging Het
Fam186a A G 15: 99,845,212 (GRCm39) M344T unknown Het
Frem1 A T 4: 82,832,029 (GRCm39) probably null Het
Gjb5 G T 4: 127,249,723 (GRCm39) D140E possibly damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Hk2 G T 6: 82,713,734 (GRCm39) S449R probably damaging Het
Hs3st3a1 A T 11: 64,411,427 (GRCm39) I322F probably benign Het
Itga1 T C 13: 115,102,196 (GRCm39) I1145V probably damaging Het
Kcp A G 6: 29,484,693 (GRCm39) L1295S probably damaging Het
Macf1 T C 4: 123,304,355 (GRCm39) D49G possibly damaging Het
Mef2b T A 8: 70,618,209 (GRCm39) D96E probably benign Het
Megf10 A T 18: 57,394,259 (GRCm39) D461V probably benign Het
Myom1 T C 17: 71,408,071 (GRCm39) S1104P probably damaging Het
Nab1 A G 1: 52,529,381 (GRCm39) L172P probably damaging Het
Or2g1 T G 17: 38,106,387 (GRCm39) D17E probably benign Het
Pate1 A G 9: 35,598,324 (GRCm39) V18A probably benign Het
Pink1 T C 4: 138,048,045 (GRCm39) probably null Het
Pnpla1 T A 17: 29,097,455 (GRCm39) I207N probably damaging Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Ppp1r21 C A 17: 88,889,840 (GRCm39) probably null Het
Rad52 A G 6: 119,891,168 (GRCm39) E76G unknown Het
Rad54l A G 4: 115,968,386 (GRCm39) probably null Het
Rasgrf2 T C 13: 92,267,954 (GRCm39) M17V probably benign Het
Rbm42 A G 7: 30,340,738 (GRCm39) M411T unknown Het
Reln A G 5: 22,256,359 (GRCm39) I495T probably benign Het
Rnf224 A G 2: 25,125,954 (GRCm39) F133S probably damaging Het
Rrm1 C A 7: 102,095,909 (GRCm39) H87Q probably damaging Het
Sec14l2 T C 11: 4,053,962 (GRCm39) D235G possibly damaging Het
Serpinb3d G T 1: 107,008,483 (GRCm39) N127K probably benign Het
Skint7 A T 4: 111,837,490 (GRCm39) E89D probably benign Het
Slc22a5 T G 11: 53,782,196 (GRCm39) N57T probably damaging Het
Smarcd3 A T 5: 24,799,982 (GRCm39) F263I probably damaging Het
Sncaip A G 18: 53,001,676 (GRCm39) I66V probably damaging Het
Syngr1 A C 15: 79,999,791 (GRCm39) probably benign Het
Tbc1d2 A G 4: 46,614,420 (GRCm39) Y554H probably benign Het
Tmem198 T C 1: 75,456,387 (GRCm39) V44A probably benign Het
Trappc11 T C 8: 47,965,320 (GRCm39) probably null Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vmn2r111 C T 17: 22,767,583 (GRCm39) C638Y probably damaging Het
Washc4 A G 10: 83,410,308 (GRCm39) Y632C probably damaging Het
Zfp92 G A X: 72,465,574 (GRCm39) R189H possibly damaging Homo
Other mutations in Zfp212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Zfp212 APN 6 47,908,256 (GRCm39) missense probably damaging 0.98
IGL03357:Zfp212 APN 6 47,907,771 (GRCm39) missense probably benign 0.28
R0122:Zfp212 UTSW 6 47,907,957 (GRCm39) missense possibly damaging 0.87
R0219:Zfp212 UTSW 6 47,903,619 (GRCm39) missense probably damaging 1.00
R0278:Zfp212 UTSW 6 47,903,453 (GRCm39) missense probably damaging 1.00
R1845:Zfp212 UTSW 6 47,908,475 (GRCm39) missense probably benign
R4910:Zfp212 UTSW 6 47,908,433 (GRCm39) missense possibly damaging 0.94
R4991:Zfp212 UTSW 6 47,903,796 (GRCm39) missense probably damaging 1.00
R5297:Zfp212 UTSW 6 47,906,011 (GRCm39) missense probably benign
R6074:Zfp212 UTSW 6 47,903,986 (GRCm39) nonsense probably null
R7275:Zfp212 UTSW 6 47,897,678 (GRCm39) missense probably benign
R7873:Zfp212 UTSW 6 47,907,860 (GRCm39) nonsense probably null
R9240:Zfp212 UTSW 6 47,906,032 (GRCm39) missense probably benign 0.32
Z1176:Zfp212 UTSW 6 47,903,702 (GRCm39) missense probably benign 0.12
Z1177:Zfp212 UTSW 6 47,903,454 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTCAAACAGGAGATGCTG -3'
(R):5'- GTTCTGTGGCAGAGTAAGACTCC -3'

Sequencing Primer
(F):5'- CTGTACAAGCAGGAAGGCCC -3'
(R):5'- GCGTGGCTCTGCAAATG -3'
Posted On 2018-04-27