Incidental Mutation 'R6369:Rbm42'
ID 512851
Institutional Source Beutler Lab
Gene Symbol Rbm42
Ensembl Gene ENSMUSG00000036733
Gene Name RNA binding motif protein 42
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R6369 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30640999-30650317 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30641313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 411 (M411T)
Ref Sequence ENSEMBL: ENSMUSP00000103776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042726] [ENSMUST00000108141]
AlphaFold Q91V81
Predicted Effect unknown
Transcript: ENSMUST00000042726
AA Change: M440T
SMART Domains Protein: ENSMUSP00000040005
Gene: ENSMUSG00000036733
AA Change: M440T

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
low complexity region 101 126 N/A INTRINSIC
low complexity region 192 217 N/A INTRINSIC
low complexity region 220 243 N/A INTRINSIC
low complexity region 247 277 N/A INTRINSIC
low complexity region 279 333 N/A INTRINSIC
low complexity region 339 355 N/A INTRINSIC
RRM 380 453 1.11e-21 SMART
low complexity region 467 474 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108141
AA Change: M411T
SMART Domains Protein: ENSMUSP00000103776
Gene: ENSMUSG00000036733
AA Change: M411T

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
low complexity region 101 126 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 191 214 N/A INTRINSIC
low complexity region 218 248 N/A INTRINSIC
low complexity region 250 304 N/A INTRINSIC
low complexity region 310 326 N/A INTRINSIC
RRM 351 424 1.11e-21 SMART
low complexity region 438 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146232
Meta Mutation Damage Score 0.8673 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Rbm42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Rbm42 APN 7 30645705 missense unknown
R0115:Rbm42 UTSW 7 30647775 missense probably damaging 1.00
R0285:Rbm42 UTSW 7 30645840 missense possibly damaging 0.93
R2144:Rbm42 UTSW 7 30641110 makesense probably null
R3122:Rbm42 UTSW 7 30649727 unclassified probably benign
R8080:Rbm42 UTSW 7 30645711 missense unknown
R8329:Rbm42 UTSW 7 30645157 missense unknown
R8372:Rbm42 UTSW 7 30641206 missense unknown
R9567:Rbm42 UTSW 7 30645970 missense possibly damaging 0.95
Z1186:Rbm42 UTSW 7 30650153 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGATCCTATCTGAGGCCCAAC -3'
(R):5'- ATCCCAGATGACTTCCGGATC -3'

Sequencing Primer
(F):5'- GATCCTATCTGAGGCCCAACTTTTTC -3'
(R):5'- AGATGACTTCCGGATCTTCTGCG -3'
Posted On 2018-04-27