Incidental Mutation 'R6369:Cd209c'
ID 512853
Institutional Source Beutler Lab
Gene Symbol Cd209c
Ensembl Gene ENSMUSG00000040165
Gene Name CD209c antigen
Synonyms SIGNR2, mSIGNR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R6369 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3940222-3954746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3944984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000039861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044060] [ENSMUST00000208622]
AlphaFold Q91ZW9
Predicted Effect probably damaging
Transcript: ENSMUST00000044060
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039861
Gene: ENSMUSG00000040165
AA Change: Y60C

DomainStartEndE-ValueType
CLECT 48 169 7.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127592
SMART Domains Protein: ENSMUSP00000120433
Gene: ENSMUSG00000040165

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153915
Predicted Effect probably benign
Transcript: ENSMUST00000208622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208902
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Cd209c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cd209c APN 8 3940339 missense probably damaging 1.00
IGL01340:Cd209c APN 8 3945892 missense probably benign 0.00
IGL02682:Cd209c APN 8 3940324 missense probably damaging 0.99
R1311:Cd209c UTSW 8 3945908 start codon destroyed probably benign
R1859:Cd209c UTSW 8 3944953 missense probably benign
R4374:Cd209c UTSW 8 3954635 exon noncoding transcript
R4375:Cd209c UTSW 8 3954635 exon noncoding transcript
R4377:Cd209c UTSW 8 3954635 exon noncoding transcript
R4769:Cd209c UTSW 8 3944953 missense probably benign
R4786:Cd209c UTSW 8 3945698 missense possibly damaging 0.77
R4841:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4842:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4869:Cd209c UTSW 8 3944077 missense probably benign 0.00
R5333:Cd209c UTSW 8 3944976 missense probably damaging 1.00
R5835:Cd209c UTSW 8 3945699 missense probably benign 0.01
R6497:Cd209c UTSW 8 3944122 missense possibly damaging 0.72
R6591:Cd209c UTSW 8 3945680 missense probably benign 0.14
R6691:Cd209c UTSW 8 3945680 missense probably benign 0.14
R7181:Cd209c UTSW 8 3945712 missense probably benign 0.01
R8067:Cd209c UTSW 8 3945700 missense probably benign 0.12
R8701:Cd209c UTSW 8 3945892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACTAGCAAACTGTGTCTCCTC -3'
(R):5'- CCAAGACTTCTGGGTTCTCATGG -3'

Sequencing Primer
(F):5'- AGCAAACTGTGTCTCCTCAGATG -3'
(R):5'- CAGGGAGGAGAGAAAGGAATGACTTC -3'
Posted On 2018-04-27