Mutagenetix > Incidental Mutation

Incidental Mutation 'R6369:Trappc11'

512855

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

044519-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6369 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

splice site (51 bp from exon)

DNA Base Change (assembly)

T to C at 47512285 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]

AlphaFold

B2RXC1

Predicted Effect

probably null
Transcript: ENSMUST00000039061

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120987

SMART Domains

Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Gryzun	1	155	4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	C	T	17: 13,835,343	R571*	probably null	Het
Asb18	A	T	1: 90,014,471	I36N	probably damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atl2	T	C	17: 79,854,555	Q205R	probably damaging	Het
Axdnd1	A	G	1: 156,392,745	I235T	probably damaging	Het
Bri3bp	A	G	5: 125,454,701	N237S	probably damaging	Het
Ccdc191	A	G	16: 43,915,485	N256S	probably benign	Het
Cchcr1	T	C	17: 35,528,176	I474T	probably damaging	Het
Cd209c	T	C	8: 3,944,984	Y60C	probably damaging	Het
Cd300c	C	A	11: 114,957,555	D171Y	probably damaging	Het
Crb1	C	T	1: 139,237,462	V975M	probably damaging	Het
Csmd1	C	T	8: 17,535,004		probably benign	Het
Ctnna2	A	G	6: 76,980,695	S524P	possibly damaging	Het
Eno1	T	C	4: 150,239,568		probably null	Het
Ero1l	T	C	14: 45,299,958	I170M	probably damaging	Het
Fam186a	A	G	15: 99,947,331	M344T	unknown	Het
Frem1	A	T	4: 82,913,792		probably null	Het
Gjb5	G	T	4: 127,355,930	D140E	possibly damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Hk2	G	T	6: 82,736,753	S449R	probably damaging	Het
Hs3st3a1	A	T	11: 64,520,601	I322F	probably benign	Het
Itga1	T	C	13: 114,965,660	I1145V	probably damaging	Het
Kcp	A	G	6: 29,484,694	L1295S	probably damaging	Het
Macf1	T	C	4: 123,410,562	D49G	possibly damaging	Het
Mef2b	T	A	8: 70,165,559	D96E	probably benign	Het
Megf10	A	T	18: 57,261,187	D461V	probably benign	Het
Myom1	T	C	17: 71,101,076	S1104P	probably damaging	Het
Nab1	A	G	1: 52,490,222	L172P	probably damaging	Het
Olfr123	T	G	17: 37,795,496	D17E	probably benign	Het
Pate1	A	G	9: 35,687,028	V18A	probably benign	Het
Pink1	T	C	4: 138,320,734		probably null	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Ppp1r21	C	A	17: 88,582,412		probably null	Het
Rad52	A	G	6: 119,914,207	E76G	unknown	Het
Rad54l	A	G	4: 116,111,189		probably null	Het
Rasgrf2	T	C	13: 92,131,446	M17V	probably benign	Het
Rbm42	A	G	7: 30,641,313	M411T	unknown	Het
Reln	A	G	5: 22,051,361	I495T	probably benign	Het
Rnf224	A	G	2: 25,235,942	F133S	probably damaging	Het
Rrm1	C	A	7: 102,446,702	H87Q	probably damaging	Het
Sec14l2	T	C	11: 4,103,962	D235G	possibly damaging	Het
Serpinb3d	G	T	1: 107,080,753	N127K	probably benign	Het
Skint7	A	T	4: 111,980,293	E89D	probably benign	Het
Slc22a5	T	G	11: 53,891,370	N57T	probably damaging	Het
Smarcd3	A	T	5: 24,594,984	F263I	probably damaging	Het
Sncaip	A	G	18: 52,868,604	I66V	probably damaging	Het
Syngr1	A	C	15: 80,115,590		probably benign	Het
Tbc1d2	A	G	4: 46,614,420	Y554H	probably benign	Het
Tmem198	T	C	1: 75,479,743	V44A	probably benign	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r111	C	T	17: 22,548,602	C638Y	probably damaging	Het
Washc4	A	G	10: 83,574,444	Y632C	probably damaging	Het
Zfp212	T	C	6: 47,930,897	V270A	probably benign	Het
Zfp92	G	A	X: 73,421,968	R189H	possibly damaging	Homo

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTAGAAAATGTTCTTTCCTGTGGTG -3'
(R):5'- TCATTGCAGAATGAAAGCCCTGAC -3'

Sequencing Primer
(F):5'- GTGGTGTTTTAAAGTAACAGTAACCG -3'
(R):5'- TGACCCTGAACCTGACTGTGATG -3'

Posted On

2018-04-27