Incidental Mutation 'R6369:Mef2b'
ID512856
Institutional Source Beutler Lab
Gene Symbol Mef2b
Ensembl Gene ENSMUSG00000079033
Gene Namemyocyte enhancer factor 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70139711-70167488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70165559 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 96 (D96E)
Ref Sequence ENSEMBL: ENSMUSP00000132314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110140] [ENSMUST00000110141] [ENSMUST00000110143] [ENSMUST00000110146] [ENSMUST00000163756]
Predicted Effect probably benign
Transcript: ENSMUST00000110140
AA Change: D96E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105767
Gene: ENSMUSG00000079033
AA Change: D96E

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110141
AA Change: D96E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105768
Gene: ENSMUSG00000079033
AA Change: D96E

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110143
AA Change: D96E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105770
Gene: ENSMUSG00000079033
AA Change: D96E

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110146
AA Change: D96E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105773
Gene: ENSMUSG00000079033
AA Change: D96E

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163756
AA Change: D96E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033
AA Change: D96E

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Mef2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Mef2b UTSW 8 70164260 missense probably damaging 1.00
R1023:Mef2b UTSW 8 70165597 missense possibly damaging 0.82
R4091:Mef2b UTSW 8 70165102 missense probably damaging 1.00
R4162:Mef2b UTSW 8 70166311 missense probably damaging 1.00
R4562:Mef2b UTSW 8 70167268 missense probably damaging 1.00
R4950:Mef2b UTSW 8 70167196 missense probably damaging 1.00
R5318:Mef2b UTSW 8 70166843 missense probably damaging 0.99
R5752:Mef2b UTSW 8 70165617 missense possibly damaging 0.77
R6126:Mef2b UTSW 8 70166876 missense probably benign 0.01
R6279:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6300:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6332:Mef2b UTSW 8 70164139 splice site probably null
R6873:Mef2b UTSW 8 70166307 missense probably benign 0.29
R7266:Mef2b UTSW 8 70164288 missense probably damaging 1.00
X0022:Mef2b UTSW 8 70166834 missense probably benign 0.41
Z1176:Mef2b UTSW 8 70166375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAACTTCAGGGGAACTCACAG -3'
(R):5'- TTAGCACTACTCCCGGAGTC -3'

Sequencing Primer
(F):5'- GGAACTCACAGTGGTTTTAGTCCC -3'
(R):5'- GTCTCAAACTCAGACTGTGTATTGG -3'
Posted On2018-04-27