Incidental Mutation 'R6369:Ascc3'
ID512858
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50699985 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 779 (G779S)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably damaging
Transcript: ENSMUST00000035606
AA Change: G779S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: G779S

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217818
Meta Mutation Damage Score 0.7373 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 splice site probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
R7479:Ascc3 UTSW 10 50649799 missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50845700 missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R8021:Ascc3 UTSW 10 50731648 missense probably benign 0.02
R8134:Ascc3 UTSW 10 50767458 missense probably benign 0.02
R8252:Ascc3 UTSW 10 50642610 missense probably benign
R8348:Ascc3 UTSW 10 50618077 missense probably benign
R8351:Ascc3 UTSW 10 50849597 missense probably benign
R8356:Ascc3 UTSW 10 50649907 missense probably benign 0.38
R8362:Ascc3 UTSW 10 50642596 missense possibly damaging 0.93
R8395:Ascc3 UTSW 10 50649304 missense possibly damaging 0.93
R8448:Ascc3 UTSW 10 50618077 missense probably benign
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50718421 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGGCTTCCTCCAAAATTTTAAG -3'
(R):5'- TGCAAAGGGAGGTAAGCTCC -3'

Sequencing Primer
(F):5'- TCACTGTTACCAAGTTATACCTTAGG -3'
(R):5'- GGAGGTAAGCTCCTACCTTAATAAC -3'
Posted On2018-04-27