Mutagenetix > Incidental Mutation

Incidental Mutation 'R6369:Washc4'

512859

Institutional Source

Beutler Lab

Gene Symbol

Washc4

Ensembl Gene

ENSMUSG00000034560

Gene Name

WASH complex subunit 4

Synonyms

A230046K03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R6369 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83543752-83596473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83574444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 632 (Y632C)

Ref Sequence

ENSEMBL: ENSMUSP00000039322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]

AlphaFold

Q3UMB9

Predicted Effect

probably damaging
Transcript: ENSMUST00000038388
AA Change: Y632C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: Y632C

Domain	Start	End	E-Value	Type
Pfam:WASH-7_N	32	604	4.8e-245	PFAM
Pfam:WASH-7_mid	605	949	7.9e-176	PFAM
low complexity region	954	965	N/A	INTRINSIC
Pfam:WASH-7_C	966	1135	9.1e-76	PFAM
low complexity region	1138	1156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217842

Meta Mutation Damage Score

0.2903

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	C	T	17: 13,835,343	R571*	probably null	Het
Asb18	A	T	1: 90,014,471	I36N	probably damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atl2	T	C	17: 79,854,555	Q205R	probably damaging	Het
Axdnd1	A	G	1: 156,392,745	I235T	probably damaging	Het
Bri3bp	A	G	5: 125,454,701	N237S	probably damaging	Het
Ccdc191	A	G	16: 43,915,485	N256S	probably benign	Het
Cchcr1	T	C	17: 35,528,176	I474T	probably damaging	Het
Cd209c	T	C	8: 3,944,984	Y60C	probably damaging	Het
Cd300c	C	A	11: 114,957,555	D171Y	probably damaging	Het
Crb1	C	T	1: 139,237,462	V975M	probably damaging	Het
Csmd1	C	T	8: 17,535,004		probably benign	Het
Ctnna2	A	G	6: 76,980,695	S524P	possibly damaging	Het
Eno1	T	C	4: 150,239,568		probably null	Het
Ero1l	T	C	14: 45,299,958	I170M	probably damaging	Het
Fam186a	A	G	15: 99,947,331	M344T	unknown	Het
Frem1	A	T	4: 82,913,792		probably null	Het
Gjb5	G	T	4: 127,355,930	D140E	possibly damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Hk2	G	T	6: 82,736,753	S449R	probably damaging	Het
Hs3st3a1	A	T	11: 64,520,601	I322F	probably benign	Het
Itga1	T	C	13: 114,965,660	I1145V	probably damaging	Het
Kcp	A	G	6: 29,484,694	L1295S	probably damaging	Het
Macf1	T	C	4: 123,410,562	D49G	possibly damaging	Het
Mef2b	T	A	8: 70,165,559	D96E	probably benign	Het
Megf10	A	T	18: 57,261,187	D461V	probably benign	Het
Myom1	T	C	17: 71,101,076	S1104P	probably damaging	Het
Nab1	A	G	1: 52,490,222	L172P	probably damaging	Het
Olfr123	T	G	17: 37,795,496	D17E	probably benign	Het
Pate1	A	G	9: 35,687,028	V18A	probably benign	Het
Pink1	T	C	4: 138,320,734		probably null	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Ppp1r21	C	A	17: 88,582,412		probably null	Het
Rad52	A	G	6: 119,914,207	E76G	unknown	Het
Rad54l	A	G	4: 116,111,189		probably null	Het
Rasgrf2	T	C	13: 92,131,446	M17V	probably benign	Het
Rbm42	A	G	7: 30,641,313	M411T	unknown	Het
Reln	A	G	5: 22,051,361	I495T	probably benign	Het
Rnf224	A	G	2: 25,235,942	F133S	probably damaging	Het
Rrm1	C	A	7: 102,446,702	H87Q	probably damaging	Het
Sec14l2	T	C	11: 4,103,962	D235G	possibly damaging	Het
Serpinb3d	G	T	1: 107,080,753	N127K	probably benign	Het
Skint7	A	T	4: 111,980,293	E89D	probably benign	Het
Slc22a5	T	G	11: 53,891,370	N57T	probably damaging	Het
Smarcd3	A	T	5: 24,594,984	F263I	probably damaging	Het
Sncaip	A	G	18: 52,868,604	I66V	probably damaging	Het
Syngr1	A	C	15: 80,115,590		probably benign	Het
Tbc1d2	A	G	4: 46,614,420	Y554H	probably benign	Het
Tmem198	T	C	1: 75,479,743	V44A	probably benign	Het
Trappc11	T	C	8: 47,512,285		probably null	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r111	C	T	17: 22,548,602	C638Y	probably damaging	Het
Zfp212	T	C	6: 47,930,897	V270A	probably benign	Het
Zfp92	G	A	X: 73,421,968	R189H	possibly damaging	Homo

Other mutations in Washc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Washc4	APN	10	83550883	missense	probably benign	0.07
IGL01370:Washc4	APN	10	83558830	missense	probably damaging	0.98
IGL01524:Washc4	APN	10	83576132	missense	probably benign	0.37
IGL01682:Washc4	APN	10	83580306	missense	possibly damaging	0.93
IGL01973:Washc4	APN	10	83556109	missense	probably damaging	0.99
IGL02002:Washc4	APN	10	83579543	missense	possibly damaging	0.95
IGL02020:Washc4	APN	10	83564472	missense	probably damaging	0.97
IGL02230:Washc4	APN	10	83581369	missense	probably benign	0.00
IGL02421:Washc4	APN	10	83579550	missense	probably damaging	0.98
IGL02514:Washc4	APN	10	83570083	missense	probably damaging	0.98
IGL02619:Washc4	APN	10	83558853	missense	possibly damaging	0.84
IGL02852:Washc4	APN	10	83583309	missense	possibly damaging	0.95
IGL02870:Washc4	APN	10	83585876	missense	probably benign
IGL03181:Washc4	APN	10	83591019	missense	probably damaging	1.00
IGL03247:Washc4	APN	10	83564463	missense	probably benign	0.02
R0458:Washc4	UTSW	10	83546799	missense	possibly damaging	0.70
R0462:Washc4	UTSW	10	83556913	missense	probably benign	0.00
R0471:Washc4	UTSW	10	83558734	splice site	probably benign
R1144:Washc4	UTSW	10	83580330	missense	probably damaging	0.97
R1560:Washc4	UTSW	10	83556109	missense	probably damaging	0.99
R1789:Washc4	UTSW	10	83579525	missense	possibly damaging	0.92
R1819:Washc4	UTSW	10	83550884	missense	probably benign	0.08
R2421:Washc4	UTSW	10	83579521	missense	probably damaging	0.97
R2882:Washc4	UTSW	10	83579501	missense	possibly damaging	0.93
R2902:Washc4	UTSW	10	83554763	nonsense	probably null
R3436:Washc4	UTSW	10	83570002	missense	probably benign	0.33
R3437:Washc4	UTSW	10	83570002	missense	probably benign	0.33
R3552:Washc4	UTSW	10	83546856	missense	probably benign	0.45
R4646:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4647:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4648:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4732:Washc4	UTSW	10	83574479	missense	probably benign
R4733:Washc4	UTSW	10	83574479	missense	probably benign
R4750:Washc4	UTSW	10	83591052	missense	probably damaging	0.99
R4835:Washc4	UTSW	10	83579512	missense	possibly damaging	0.93
R5024:Washc4	UTSW	10	83583336	missense	possibly damaging	0.71
R5055:Washc4	UTSW	10	83556907	missense	probably damaging	0.99
R5414:Washc4	UTSW	10	83556103	missense	possibly damaging	0.95
R5423:Washc4	UTSW	10	83579554	missense	possibly damaging	0.71
R5428:Washc4	UTSW	10	83574522	missense	probably benign	0.00
R5506:Washc4	UTSW	10	83581337	missense	probably damaging	0.97
R5540:Washc4	UTSW	10	83573793	missense	probably damaging	0.99
R5667:Washc4	UTSW	10	83570028	missense	probably damaging	0.97
R5671:Washc4	UTSW	10	83570028	missense	probably damaging	0.97
R5777:Washc4	UTSW	10	83555605	missense	probably damaging	1.00
R6370:Washc4	UTSW	10	83571362	missense	possibly damaging	0.85
R6500:Washc4	UTSW	10	83558823	missense	probably damaging	1.00
R6645:Washc4	UTSW	10	83572195	nonsense	probably null
R6657:Washc4	UTSW	10	83558618	missense	possibly damaging	0.92
R6829:Washc4	UTSW	10	83560516	missense	probably damaging	0.97
R6862:Washc4	UTSW	10	83558893	missense	possibly damaging	0.92
R6899:Washc4	UTSW	10	83576055	missense	probably benign	0.07
R7144:Washc4	UTSW	10	83573774	critical splice acceptor site	probably null
R7163:Washc4	UTSW	10	83591033	missense	probably damaging	0.99
R7477:Washc4	UTSW	10	83574443	missense	probably damaging	0.99
R7900:Washc4	UTSW	10	83573773	splice site	probably null
R8491:Washc4	UTSW	10	83576123	missense	probably benign	0.24
R8791:Washc4	UTSW	10	83550884	missense	probably benign	0.08
R8804:Washc4	UTSW	10	83572151	missense	probably damaging	0.99
R8896:Washc4	UTSW	10	83570018	missense	probably damaging	0.98
R8961:Washc4	UTSW	10	83573793	missense	probably damaging	0.99
R9084:Washc4	UTSW	10	83586635	missense	possibly damaging	0.92
R9452:Washc4	UTSW	10	83560523	missense	probably benign
X0017:Washc4	UTSW	10	83591143	missense	probably damaging	1.00
X0066:Washc4	UTSW	10	83558829	frame shift	probably null
Z1088:Washc4	UTSW	10	83576741	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GGCTGCATGTTACTCAGTTTC -3'
(R):5'- CATCTTCCAAAGCACTGCTC -3'

Sequencing Primer
(F):5'- ACTCAGTTTCTCTGTGGAAGTC -3'
(R):5'- ATTACAGATGGTTGTGAGCCACC -3'

Posted On

2018-04-27