Incidental Mutation 'R6369:Sec14l2'
ID512860
Institutional Source Beutler Lab
Gene Symbol Sec14l2
Ensembl Gene ENSMUSG00000003585
Gene NameSEC14-like lipid binding 2
SynonymsSpf, tap, 1300013M05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_144520.2; MGI:1915065

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4097039-4123415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4103962 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 235 (D235G)
Ref Sequence ENSEMBL: ENSMUSP00000003681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003681]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003681
AA Change: D235G

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003681
Gene: ENSMUSG00000003585
AA Change: D235G

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.16e-6 SMART
SEC14 76 246 8.31e-62 SMART
Blast:SEC14 257 338 2e-42 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133631
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype Strain: 3771069
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased cholesterol synthesis and plasma levels under fasting conditions compared to wild-type mice. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Sec14l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Sec14l2 APN 11 4098317 missense probably benign
IGL01369:Sec14l2 APN 11 4103432 missense probably benign 0.03
IGL01404:Sec14l2 APN 11 4116710 missense possibly damaging 0.71
IGL01622:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL01623:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL02007:Sec14l2 APN 11 4111114 missense probably benign 0.00
IGL02632:Sec14l2 APN 11 4111222 missense probably benign 0.00
IGL02644:Sec14l2 APN 11 4103380 splice site probably benign
Samoas UTSW 11 4103980 missense possibly damaging 0.74
P0027:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
PIT1430001:Sec14l2 UTSW 11 4109209 nonsense probably null
R0113:Sec14l2 UTSW 11 4103661 splice site probably benign
R1705:Sec14l2 UTSW 11 4103980 missense possibly damaging 0.74
R2044:Sec14l2 UTSW 11 4111435 splice site probably benign
R2180:Sec14l2 UTSW 11 4108964 missense probably damaging 1.00
R2215:Sec14l2 UTSW 11 4109169 missense probably damaging 1.00
R5301:Sec14l2 UTSW 11 4118727 start gained probably benign
R5668:Sec14l2 UTSW 11 4109189 missense probably damaging 1.00
R5949:Sec14l2 UTSW 11 4108972 missense probably damaging 1.00
R6050:Sec14l2 UTSW 11 4111477 missense probably benign 0.36
R6467:Sec14l2 UTSW 11 4111161 missense probably damaging 1.00
R6798:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7142:Sec14l2 UTSW 11 4098379 missense probably benign 0.04
R7385:Sec14l2 UTSW 11 4116750 nonsense probably null
R7594:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7704:Sec14l2 UTSW 11 4108574 missense probably benign 0.19
R8438:Sec14l2 UTSW 11 4109202 nonsense probably null
T0722:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
X0067:Sec14l2 UTSW 11 4116737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGGAATGTCGCCCC -3'
(R):5'- CCCACAACTGTGCTCCAT -3'

Sequencing Primer
(F):5'- GAATGTCGCCCCCATAGTTG -3'
(R):5'- ACGCACACACATACACTTTATAC -3'
Posted On2018-04-27