Incidental Mutation 'R6369:Slc22a5'
ID512861
Institutional Source Beutler Lab
Gene Symbol Slc22a5
Ensembl Gene ENSMUSG00000018900
Gene Namesolute carrier family 22 (organic cation transporter), member 5
SynonymsLstpl, Octn2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53864542-53891660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 53891370 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 57 (N57T)
Ref Sequence ENSEMBL: ENSMUSP00000019044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019044] [ENSMUST00000136307]
Predicted Effect probably damaging
Transcript: ENSMUST00000019044
AA Change: N57T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019044
Gene: ENSMUSG00000018900
AA Change: N57T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 57 524 1.7e-28 PFAM
Pfam:MFS_1 138 478 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136307
AA Change: N57T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118900
Gene: ENSMUSG00000018900
AA Change: N57T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Meta Mutation Damage Score 0.2245 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a spontaneous missense mutation exhibit systemic carnitine deficiency, cardiac hypertrophy, impaired Na-dependent carnitine transport, fatty liver, hypoglycemia, high postnatal mortality, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Slc22a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Slc22a5 APN 11 53867664 missense probably benign 0.39
IGL02063:Slc22a5 APN 11 53875073 missense probably damaging 0.99
IGL03008:Slc22a5 APN 11 53891232 missense probably damaging 1.00
IGL03190:Slc22a5 APN 11 53875014 missense probably benign 0.02
R0055:Slc22a5 UTSW 11 53891206 missense probably benign 0.00
R0190:Slc22a5 UTSW 11 53869415 nonsense probably null
R1498:Slc22a5 UTSW 11 53869314 missense probably damaging 1.00
R1729:Slc22a5 UTSW 11 53866351 missense probably damaging 1.00
R1784:Slc22a5 UTSW 11 53866351 missense probably damaging 1.00
R2249:Slc22a5 UTSW 11 53883706 missense possibly damaging 0.73
R3426:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3427:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3428:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3895:Slc22a5 UTSW 11 53865825 missense possibly damaging 0.64
R4582:Slc22a5 UTSW 11 53891209 missense probably damaging 1.00
R4965:Slc22a5 UTSW 11 53891526 missense possibly damaging 0.94
R5898:Slc22a5 UTSW 11 53873733 missense probably damaging 1.00
R6018:Slc22a5 UTSW 11 53876020 missense probably damaging 1.00
R6063:Slc22a5 UTSW 11 53867533 missense possibly damaging 0.79
R6218:Slc22a5 UTSW 11 53891618 unclassified probably benign
R6827:Slc22a5 UTSW 11 53871616 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACGTCCTTGTCGTACTCC -3'
(R):5'- TAGTTCTGAGTCCTAGCTCGGC -3'

Sequencing Primer
(F):5'- GTCGTACTCCCAGCCATCCAG -3'
(R):5'- CCTCAGGCCCTATGTAAAGTTGG -3'
Posted On2018-04-27