Mutagenetix > Incidental Mutations

Incidental Mutation 'R6369:Itga1'

512866

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R6369 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114965660 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1145 (I1145V)

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061673
AA Change: I1145V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: I1145V

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	C	T	17: 13,835,343	R571*	probably null	Het
Asb18	A	T	1: 90,014,471	I36N	probably damaging	Het
Ascc3	G	A	10: 50,699,985	G779S	probably damaging	Het
Atl2	T	C	17: 79,854,555	Q205R	probably damaging	Het
Axdnd1	A	G	1: 156,392,745	I235T	probably damaging	Het
Bri3bp	A	G	5: 125,454,701	N237S	probably damaging	Het
Ccdc191	A	G	16: 43,915,485	N256S	probably benign	Het
Cchcr1	T	C	17: 35,528,176	I474T	probably damaging	Het
Cd209c	T	C	8: 3,944,984	Y60C	probably damaging	Het
Cd300c	C	A	11: 114,957,555	D171Y	probably damaging	Het
Crb1	C	T	1: 139,237,462	V975M	probably damaging	Het
Csmd1	C	T	8: 17,535,004		probably benign	Het
Ctnna2	A	G	6: 76,980,695	S524P	possibly damaging	Het
Eno1	T	C	4: 150,239,568		probably null	Het
Ero1l	T	C	14: 45,299,958	I170M	probably damaging	Het
Fam186a	A	G	15: 99,947,331	M344T	unknown	Het
Frem1	A	T	4: 82,913,792		probably null	Het
Gjb5	G	T	4: 127,355,930	D140E	possibly damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Hk2	G	T	6: 82,736,753	S449R	probably damaging	Het
Hs3st3a1	A	T	11: 64,520,601	I322F	probably benign	Het
Kcp	A	G	6: 29,484,694	L1295S	probably damaging	Het
Macf1	T	C	4: 123,410,562	D49G	possibly damaging	Het
Mef2b	T	A	8: 70,165,559	D96E	probably benign	Het
Megf10	A	T	18: 57,261,187	D461V	probably benign	Het
Myom1	T	C	17: 71,101,076	S1104P	probably damaging	Het
Nab1	A	G	1: 52,490,222	L172P	probably damaging	Het
Olfr123	T	G	17: 37,795,496	D17E	probably benign	Het
Pate1	A	G	9: 35,687,028	V18A	probably benign	Het
Pink1	T	C	4: 138,320,734		probably null	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Ppp1r21	C	A	17: 88,582,412		probably null	Het
Rad52	A	G	6: 119,914,207	E76G	unknown	Het
Rad54l	A	G	4: 116,111,189		probably null	Het
Rasgrf2	T	C	13: 92,131,446	M17V	probably benign	Het
Rbm42	A	G	7: 30,641,313	M411T	unknown	Het
Reln	A	G	5: 22,051,361	I495T	probably benign	Het
Rnf224	A	G	2: 25,235,942	F133S	probably damaging	Het
Rrm1	C	A	7: 102,446,702	H87Q	probably damaging	Het
Sec14l2	T	C	11: 4,103,962	D235G	possibly damaging	Het
Serpinb3d	G	T	1: 107,080,753	N127K	probably benign	Het
Skint7	A	T	4: 111,980,293	E89D	probably benign	Het
Slc22a5	T	G	11: 53,891,370	N57T	probably damaging	Het
Smarcd3	A	T	5: 24,594,984	F263I	probably damaging	Het
Sncaip	A	G	18: 52,868,604	I66V	probably damaging	Het
Syngr1	A	C	15: 80,115,590		probably benign	Het
Tbc1d2	A	G	4: 46,614,420	Y554H	probably benign	Het
Tmem198	T	C	1: 75,479,743	V44A	probably benign	Het
Trappc11	T	C	8: 47,512,285		probably null	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r111	C	T	17: 22,548,602	C638Y	probably damaging	Het
Washc4	A	G	10: 83,574,444	Y632C	probably damaging	Het
Zfp212	T	C	6: 47,930,897	V270A	probably benign	Het
Zfp92	G	A	X: 73,421,968	R189H	possibly damaging	Homo

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0244:Itga1	UTSW	13	115006897	splice site	probably benign
R0265:Itga1	UTSW	13	114992459	missense	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5155:Itga1	UTSW	13	115035303	missense	probably benign
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6663:Itga1	UTSW	13	114974105	missense	probably benign	0.02
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7591:Itga1	UTSW	13	114982779	missense	probably damaging	1.00
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7615:Itga1	UTSW	13	114996922	missense	probably null	0.99
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTCTTCTCACATGAAAGCTTGCAC -3'
(R):5'- AAACTCTGTTTCGAACTGCTCTAC -3'

Sequencing Primer
(F):5'- GCTTGCACTTTATTATGTACGAGAGC -3'
(R):5'- TGAAAGGCATTCTCAAACGTAAAC -3'

Posted On

2018-04-27