Incidental Mutation 'R6369:Ero1l'
ID512867
Institutional Source Beutler Lab
Gene Symbol Ero1l
Ensembl Gene ENSMUSG00000021831
Gene NameERO1-like (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location45283087-45318771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45299958 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 170 (I170M)
Ref Sequence ENSEMBL: ENSMUSP00000022378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022378]
Predicted Effect probably damaging
Transcript: ENSMUST00000022378
AA Change: I170M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022378
Gene: ENSMUSG00000021831
AA Change: I170M

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:ERO1 60 453 3.7e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227147
Predicted Effect probably benign
Transcript: ENSMUST00000227315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228836
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of the endoplasmic reticulum oxidoreductin family. The encoded protein is localized to the endoplasmic reticulum and promotes the formation of disulfide bonds by oxidizing protein disulfide isomerase. This gene may play a role in endoplasmic reticulum stress-induced apoptosis and the cellular response to hypoxia. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased apoptosis and calcium release in macrophages exposed to endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Ero1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ero1l APN 14 45303586 missense probably benign 0.19
IGL01672:Ero1l APN 14 45292430 missense probably benign 0.05
IGL01914:Ero1l APN 14 45306612 missense probably damaging 1.00
IGL01979:Ero1l APN 14 45287744 missense probably damaging 1.00
IGL02302:Ero1l APN 14 45293162 missense probably benign 0.34
IGL03351:Ero1l APN 14 45294533 missense probably benign
R0844:Ero1l UTSW 14 45293000 missense probably damaging 1.00
R1696:Ero1l UTSW 14 45299935 missense probably damaging 1.00
R1828:Ero1l UTSW 14 45287760 missense probably damaging 1.00
R2410:Ero1l UTSW 14 45305266 missense possibly damaging 0.89
R2504:Ero1l UTSW 14 45299088 splice site probably null
R3415:Ero1l UTSW 14 45287866 missense possibly damaging 0.91
R3417:Ero1l UTSW 14 45287866 missense possibly damaging 0.91
R4074:Ero1l UTSW 14 45292436 splice site probably null
R6899:Ero1l UTSW 14 45292939 missense probably benign 0.00
R7052:Ero1l UTSW 14 45306583 nonsense probably null
R7064:Ero1l UTSW 14 45306592 missense probably damaging 0.96
R7516:Ero1l UTSW 14 45288023 missense probably benign 0.06
R7520:Ero1l UTSW 14 45306575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCATTTTAGTTTCTATGTCCT -3'
(R):5'- TCTGCATTGGCTAGGCAAAA -3'

Sequencing Primer
(F):5'- GATCTGCACAGGTCTAGA -3'
(R):5'- TGTTAAGCATCCCAGCTAAGGTC -3'
Posted On2018-04-27