Incidental Mutation 'R6369:Afdn'
ID 512871
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Name afadin, adherens junction formation factor
Synonyms Mllt4, AF6, S-afadin, Afadin, I-afadin, 5033403D15Rik
MMRRC Submission 044519-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6369 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 13980735-14126059 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 14055605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 571 (R571*)
Ref Sequence ENSEMBL: ENSMUSP00000128891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137495
Predicted Effect probably null
Transcript: ENSMUST00000137708
AA Change: R586*
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: R586*

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137784
AA Change: R586*
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: R586*

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139666
AA Change: R586*
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: R586*

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150848
AA Change: R571*
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: R571*

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170827
AA Change: R571*
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: R571*

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb18 A T 1: 89,942,193 (GRCm39) I36N probably damaging Het
Ascc3 G A 10: 50,576,081 (GRCm39) G779S probably damaging Het
Atl2 T C 17: 80,161,984 (GRCm39) Q205R probably damaging Het
Axdnd1 A G 1: 156,220,315 (GRCm39) I235T probably damaging Het
Bri3bp A G 5: 125,531,765 (GRCm39) N237S probably damaging Het
Ccdc191 A G 16: 43,735,848 (GRCm39) N256S probably benign Het
Cchcr1 T C 17: 35,839,073 (GRCm39) I474T probably damaging Het
Cd209c T C 8: 3,994,984 (GRCm39) Y60C probably damaging Het
Cd300c C A 11: 114,848,381 (GRCm39) D171Y probably damaging Het
Crb1 C T 1: 139,165,200 (GRCm39) V975M probably damaging Het
Csmd1 C T 8: 17,585,020 (GRCm39) probably benign Het
Ctnna2 A G 6: 76,957,678 (GRCm39) S524P possibly damaging Het
Eno1 T C 4: 150,324,025 (GRCm39) probably null Het
Ero1a T C 14: 45,537,415 (GRCm39) I170M probably damaging Het
Fam186a A G 15: 99,845,212 (GRCm39) M344T unknown Het
Frem1 A T 4: 82,832,029 (GRCm39) probably null Het
Gjb5 G T 4: 127,249,723 (GRCm39) D140E possibly damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Hk2 G T 6: 82,713,734 (GRCm39) S449R probably damaging Het
Hs3st3a1 A T 11: 64,411,427 (GRCm39) I322F probably benign Het
Itga1 T C 13: 115,102,196 (GRCm39) I1145V probably damaging Het
Kcp A G 6: 29,484,693 (GRCm39) L1295S probably damaging Het
Macf1 T C 4: 123,304,355 (GRCm39) D49G possibly damaging Het
Mef2b T A 8: 70,618,209 (GRCm39) D96E probably benign Het
Megf10 A T 18: 57,394,259 (GRCm39) D461V probably benign Het
Myom1 T C 17: 71,408,071 (GRCm39) S1104P probably damaging Het
Nab1 A G 1: 52,529,381 (GRCm39) L172P probably damaging Het
Or2g1 T G 17: 38,106,387 (GRCm39) D17E probably benign Het
Pate1 A G 9: 35,598,324 (GRCm39) V18A probably benign Het
Pink1 T C 4: 138,048,045 (GRCm39) probably null Het
Pnpla1 T A 17: 29,097,455 (GRCm39) I207N probably damaging Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Ppp1r21 C A 17: 88,889,840 (GRCm39) probably null Het
Rad52 A G 6: 119,891,168 (GRCm39) E76G unknown Het
Rad54l A G 4: 115,968,386 (GRCm39) probably null Het
Rasgrf2 T C 13: 92,267,954 (GRCm39) M17V probably benign Het
Rbm42 A G 7: 30,340,738 (GRCm39) M411T unknown Het
Reln A G 5: 22,256,359 (GRCm39) I495T probably benign Het
Rnf224 A G 2: 25,125,954 (GRCm39) F133S probably damaging Het
Rrm1 C A 7: 102,095,909 (GRCm39) H87Q probably damaging Het
Sec14l2 T C 11: 4,053,962 (GRCm39) D235G possibly damaging Het
Serpinb3d G T 1: 107,008,483 (GRCm39) N127K probably benign Het
Skint7 A T 4: 111,837,490 (GRCm39) E89D probably benign Het
Slc22a5 T G 11: 53,782,196 (GRCm39) N57T probably damaging Het
Smarcd3 A T 5: 24,799,982 (GRCm39) F263I probably damaging Het
Sncaip A G 18: 53,001,676 (GRCm39) I66V probably damaging Het
Syngr1 A C 15: 79,999,791 (GRCm39) probably benign Het
Tbc1d2 A G 4: 46,614,420 (GRCm39) Y554H probably benign Het
Tmem198 T C 1: 75,456,387 (GRCm39) V44A probably benign Het
Trappc11 T C 8: 47,965,320 (GRCm39) probably null Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vmn2r111 C T 17: 22,767,583 (GRCm39) C638Y probably damaging Het
Washc4 A G 10: 83,410,308 (GRCm39) Y632C probably damaging Het
Zfp212 T C 6: 47,907,831 (GRCm39) V270A probably benign Het
Zfp92 G A X: 72,465,574 (GRCm39) R189H possibly damaging Homo
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 14,104,890 (GRCm39) missense probably damaging 1.00
IGL00784:Afdn APN 17 14,069,525 (GRCm39) splice site probably benign
IGL00971:Afdn APN 17 14,072,575 (GRCm39) splice site probably benign
IGL01403:Afdn APN 17 14,124,132 (GRCm39) missense probably damaging 1.00
IGL01944:Afdn APN 17 14,030,743 (GRCm39) missense probably damaging 1.00
IGL02474:Afdn APN 17 14,038,491 (GRCm39) missense probably damaging 1.00
IGL02615:Afdn APN 17 14,046,238 (GRCm39) missense probably benign 0.00
IGL02664:Afdn APN 17 14,072,728 (GRCm39) splice site probably benign
IGL03036:Afdn APN 17 14,108,350 (GRCm39) missense probably benign 0.12
jubilee UTSW 17 14,108,248 (GRCm39) missense probably damaging 1.00
IGL03134:Afdn UTSW 17 14,066,548 (GRCm39) missense probably benign 0.04
R0112:Afdn UTSW 17 14,104,899 (GRCm39) missense probably damaging 1.00
R0226:Afdn UTSW 17 14,119,408 (GRCm39) missense probably benign 0.00
R0305:Afdn UTSW 17 14,108,776 (GRCm39) splice site probably null
R0310:Afdn UTSW 17 14,105,770 (GRCm39) critical splice donor site probably null
R0711:Afdn UTSW 17 14,072,698 (GRCm39) missense probably damaging 1.00
R0828:Afdn UTSW 17 14,124,260 (GRCm39) missense probably damaging 1.00
R1268:Afdn UTSW 17 14,108,248 (GRCm39) missense probably damaging 1.00
R1317:Afdn UTSW 17 14,066,535 (GRCm39) missense probably benign 0.11
R1386:Afdn UTSW 17 14,066,798 (GRCm39) missense probably damaging 1.00
R1438:Afdn UTSW 17 14,075,652 (GRCm39) missense probably damaging 1.00
R1607:Afdn UTSW 17 14,030,763 (GRCm39) missense probably damaging 1.00
R1819:Afdn UTSW 17 14,071,110 (GRCm39) missense probably damaging 1.00
R1872:Afdn UTSW 17 14,101,578 (GRCm39) missense probably damaging 1.00
R1880:Afdn UTSW 17 14,072,615 (GRCm39) missense possibly damaging 0.84
R2049:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2140:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2142:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2162:Afdn UTSW 17 14,116,436 (GRCm39) missense probably benign 0.01
R2221:Afdn UTSW 17 14,103,999 (GRCm39) splice site probably benign
R2223:Afdn UTSW 17 14,103,999 (GRCm39) splice site probably benign
R2291:Afdn UTSW 17 14,109,153 (GRCm39) missense probably damaging 1.00
R2993:Afdn UTSW 17 14,111,262 (GRCm39) critical splice donor site probably null
R3402:Afdn UTSW 17 14,104,176 (GRCm39) missense probably damaging 1.00
R3403:Afdn UTSW 17 14,104,176 (GRCm39) missense probably damaging 1.00
R3690:Afdn UTSW 17 14,108,671 (GRCm39) missense probably damaging 1.00
R3691:Afdn UTSW 17 14,108,671 (GRCm39) missense probably damaging 1.00
R3764:Afdn UTSW 17 14,066,851 (GRCm39) missense probably benign 0.07
R3832:Afdn UTSW 17 14,116,436 (GRCm39) missense probably benign 0.01
R4002:Afdn UTSW 17 14,104,179 (GRCm39) missense probably damaging 1.00
R4440:Afdn UTSW 17 14,071,152 (GRCm39) missense probably damaging 1.00
R4621:Afdn UTSW 17 14,109,082 (GRCm39) missense probably damaging 1.00
R4935:Afdn UTSW 17 14,111,228 (GRCm39) missense probably benign 0.30
R5279:Afdn UTSW 17 14,109,214 (GRCm39) missense probably damaging 1.00
R5421:Afdn UTSW 17 14,052,668 (GRCm39) missense probably benign 0.25
R5689:Afdn UTSW 17 14,075,621 (GRCm39) missense probably damaging 1.00
R6332:Afdn UTSW 17 14,030,707 (GRCm39) missense possibly damaging 0.92
R6433:Afdn UTSW 17 14,101,561 (GRCm39) missense probably damaging 1.00
R6467:Afdn UTSW 17 14,024,315 (GRCm39) missense probably damaging 1.00
R6500:Afdn UTSW 17 14,042,634 (GRCm39) missense possibly damaging 0.67
R6564:Afdn UTSW 17 14,116,351 (GRCm39) missense probably benign
R6705:Afdn UTSW 17 14,108,283 (GRCm39) missense probably benign 0.01
R6733:Afdn UTSW 17 14,043,615 (GRCm39) missense probably benign 0.39
R6983:Afdn UTSW 17 14,101,583 (GRCm39) missense probably damaging 1.00
R7089:Afdn UTSW 17 14,111,074 (GRCm39) splice site probably null
R7161:Afdn UTSW 17 14,109,208 (GRCm39) missense possibly damaging 0.55
R7175:Afdn UTSW 17 14,108,869 (GRCm39) missense probably damaging 1.00
R7492:Afdn UTSW 17 14,068,638 (GRCm39) critical splice donor site probably null
R7567:Afdn UTSW 17 14,109,070 (GRCm39) missense probably benign 0.19
R7581:Afdn UTSW 17 14,069,500 (GRCm39) missense probably damaging 1.00
R7694:Afdn UTSW 17 14,109,144 (GRCm39) missense probably damaging 0.99
R7722:Afdn UTSW 17 14,029,231 (GRCm39) missense probably benign 0.40
R7794:Afdn UTSW 17 14,102,695 (GRCm39) missense probably damaging 1.00
R8039:Afdn UTSW 17 14,119,403 (GRCm39) missense probably damaging 0.99
R8444:Afdn UTSW 17 14,104,062 (GRCm39) missense probably benign 0.31
R8694:Afdn UTSW 17 14,108,641 (GRCm39) missense probably benign
R8728:Afdn UTSW 17 14,119,207 (GRCm39) missense probably damaging 1.00
R8770:Afdn UTSW 17 14,104,199 (GRCm39) critical splice donor site probably null
R8887:Afdn UTSW 17 14,116,401 (GRCm39) nonsense probably null
R9101:Afdn UTSW 17 14,043,706 (GRCm39) missense probably damaging 0.99
R9169:Afdn UTSW 17 14,072,627 (GRCm39) missense probably benign 0.02
R9275:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9276:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9277:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9278:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9281:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9573:Afdn UTSW 17 14,050,229 (GRCm39) missense probably damaging 1.00
R9619:Afdn UTSW 17 14,101,566 (GRCm39) missense probably damaging 1.00
R9746:Afdn UTSW 17 14,066,782 (GRCm39) missense probably benign 0.00
R9797:Afdn UTSW 17 14,066,562 (GRCm39) missense probably benign
X0060:Afdn UTSW 17 14,038,432 (GRCm39) nonsense probably null
X0064:Afdn UTSW 17 14,108,289 (GRCm39) missense possibly damaging 0.60
Z1088:Afdn UTSW 17 14,104,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTGCTAAGTGGAAAGC -3'
(R):5'- AAGTGTGACCCAACATGCCC -3'

Sequencing Primer
(F):5'- TGCTAAGTGGAAAGCCGATG -3'
(R):5'- AACATGCCCGTGTGTCAG -3'
Posted On 2018-04-27