Incidental Mutation 'R6369:Ppp1r21'
ID512878
Institutional Source Beutler Lab
Gene Symbol Ppp1r21
Ensembl Gene ENSMUSG00000034709
Gene Nameprotein phosphatase 1, regulatory subunit 21
SynonymsKlraq1, 1110018J12Rik, Ccdc128
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location88530118-88588367 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 88582412 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038551]
Predicted Effect probably null
Transcript: ENSMUST00000038551
SMART Domains Protein: ENSMUSP00000048443
Gene: ENSMUSG00000034709

DomainStartEndE-ValueType
KLRAQ 11 112 8.01e-51 SMART
coiled coil region 136 211 N/A INTRINSIC
Pfam:TTKRSYEDQ 255 771 1.8e-273 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190136
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Ppp1r21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ppp1r21 APN 17 88562102 splice site probably benign
IGL02366:Ppp1r21 APN 17 88547662 missense probably damaging 0.99
IGL02604:Ppp1r21 APN 17 88572743 missense probably benign 0.00
IGL02680:Ppp1r21 APN 17 88583862 missense probably benign 0.00
R0266:Ppp1r21 UTSW 17 88569072 splice site probably benign
R0436:Ppp1r21 UTSW 17 88565689 missense possibly damaging 0.96
R1398:Ppp1r21 UTSW 17 88542879 missense probably damaging 1.00
R1472:Ppp1r21 UTSW 17 88558605 missense probably damaging 1.00
R1599:Ppp1r21 UTSW 17 88572627 missense probably benign 0.00
R1677:Ppp1r21 UTSW 17 88550669 missense probably benign 0.04
R1760:Ppp1r21 UTSW 17 88562225 missense possibly damaging 0.78
R2571:Ppp1r21 UTSW 17 88545382 missense probably benign 0.06
R3700:Ppp1r21 UTSW 17 88582454 missense possibly damaging 0.88
R3786:Ppp1r21 UTSW 17 88577127 splice site probably null
R3959:Ppp1r21 UTSW 17 88549816 missense probably damaging 1.00
R4649:Ppp1r21 UTSW 17 88549513 missense probably benign
R4654:Ppp1r21 UTSW 17 88558799 missense probably benign 0.01
R4724:Ppp1r21 UTSW 17 88555591 nonsense probably null
R4766:Ppp1r21 UTSW 17 88572615 missense probably benign 0.00
R4933:Ppp1r21 UTSW 17 88547621 missense probably benign 0.07
R4934:Ppp1r21 UTSW 17 88545375 missense probably damaging 1.00
R4934:Ppp1r21 UTSW 17 88545376 missense probably damaging 0.98
R4992:Ppp1r21 UTSW 17 88569080 missense probably benign 0.44
R5109:Ppp1r21 UTSW 17 88558840 missense probably damaging 1.00
R5372:Ppp1r21 UTSW 17 88550675 missense probably benign 0.21
R5861:Ppp1r21 UTSW 17 88582509 missense probably damaging 1.00
R6200:Ppp1r21 UTSW 17 88569185 missense possibly damaging 0.65
R7060:Ppp1r21 UTSW 17 88580544 missense probably damaging 1.00
R7154:Ppp1r21 UTSW 17 88554886 missense probably damaging 0.99
R7390:Ppp1r21 UTSW 17 88549530 missense probably benign 0.26
R7470:Ppp1r21 UTSW 17 88562221 missense probably damaging 1.00
R7475:Ppp1r21 UTSW 17 88555603 missense probably benign 0.07
R7657:Ppp1r21 UTSW 17 88555682 missense probably damaging 1.00
R8021:Ppp1r21 UTSW 17 88549507 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTATGTGCTTGTAACCATTGGC -3'
(R):5'- GTGGAGCATGTGTCAAGACC -3'

Sequencing Primer
(F):5'- ACCATTGGCCATTAGACTGCTGAG -3'
(R):5'- TGTGTCAAGACCAGACATCACTG -3'
Posted On2018-04-27