Incidental Mutation 'R6369:Sncaip'
ID512879
Institutional Source Beutler Lab
Gene Symbol Sncaip
Ensembl Gene ENSMUSG00000024534
Gene Namesynuclein, alpha interacting protein (synphilin)
Synonymssynphilin-1, 4933427B05Rik, SYPH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R6369 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location52767709-52915935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52868604 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 66 (I66V)
Ref Sequence ENSEMBL: ENSMUSP00000136838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025413] [ENSMUST00000115410] [ENSMUST00000163742] [ENSMUST00000177861] [ENSMUST00000178011] [ENSMUST00000178678] [ENSMUST00000178883] [ENSMUST00000179625] [ENSMUST00000179689] [ENSMUST00000180259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025413
AA Change: I66V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025413
Gene: ENSMUSG00000024534
AA Change: I66V

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115410
AA Change: I66V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111069
Gene: ENSMUSG00000024534
AA Change: I66V

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163742
AA Change: I66V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127189
Gene: ENSMUSG00000024534
AA Change: I66V

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177861
Predicted Effect possibly damaging
Transcript: ENSMUST00000178011
AA Change: I66V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137549
Gene: ENSMUSG00000024534
AA Change: I66V

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178678
AA Change: I66V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137367
Gene: ENSMUSG00000024534
AA Change: I66V

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
Pfam:SNCAIP_SNCA_bd 511 556 7.9e-30 PFAM
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178883
Predicted Effect probably damaging
Transcript: ENSMUST00000179625
AA Change: I66V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136838
Gene: ENSMUSG00000024534
AA Change: I66V

DomainStartEndE-ValueType
ANK 358 387 5.03e2 SMART
ANK 395 424 4.26e-4 SMART
PDB:2KES|A 451 489 9e-10 PDB
low complexity region 490 511 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 809 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179689
SMART Domains Protein: ENSMUSP00000137107
Gene: ENSMUSG00000024534

DomainStartEndE-ValueType
ANK 43 72 4.26e-4 SMART
PDB:2KES|A 99 137 6e-10 PDB
low complexity region 138 159 N/A INTRINSIC
low complexity region 244 257 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 333 343 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 457 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180259
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several protein-protein interaction domains, including ankyrin-like repeats, a coiled-coil domain, and an ATP/GTP-binding motif. The encoded protein interacts with alpha-synuclein in neuronal tissue and may play a role in the formation of cytoplasmic inclusions and neurodegeneration. A mutation in this gene has been associated with Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rnf224 A G 2: 25,235,942 F133S probably damaging Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Sncaip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sncaip APN 18 52884963 intron probably null
IGL01554:Sncaip APN 18 52868934 missense possibly damaging 0.94
IGL01802:Sncaip APN 18 52869037 missense probably damaging 1.00
IGL02658:Sncaip APN 18 52894955 missense possibly damaging 0.50
IGL02737:Sncaip APN 18 52907056 missense probably benign 0.10
IGL03017:Sncaip APN 18 52894937 missense possibly damaging 0.82
PIT4445001:Sncaip UTSW 18 52868944 missense probably damaging 1.00
R0218:Sncaip UTSW 18 52907328 missense probably benign 0.18
R0325:Sncaip UTSW 18 52905809 missense probably damaging 1.00
R0450:Sncaip UTSW 18 52868709 missense probably benign 0.08
R0469:Sncaip UTSW 18 52868709 missense probably benign 0.08
R1494:Sncaip UTSW 18 52868886 missense probably damaging 0.99
R1897:Sncaip UTSW 18 52894790 intron probably null
R1962:Sncaip UTSW 18 52871362 missense probably damaging 1.00
R2238:Sncaip UTSW 18 52868547 missense probably damaging 1.00
R2935:Sncaip UTSW 18 52838032 missense probably damaging 1.00
R4044:Sncaip UTSW 18 52907403 missense probably benign 0.01
R4694:Sncaip UTSW 18 52906557 missense probably benign 0.00
R4810:Sncaip UTSW 18 52907199 missense possibly damaging 0.47
R4850:Sncaip UTSW 18 52871384 missense probably damaging 1.00
R4857:Sncaip UTSW 18 52869225 missense probably benign 0.00
R4939:Sncaip UTSW 18 52907263 missense possibly damaging 0.53
R5384:Sncaip UTSW 18 52885041 missense probably damaging 1.00
R5610:Sncaip UTSW 18 52868919 missense probably benign
R5645:Sncaip UTSW 18 52894956 missense probably damaging 1.00
R5797:Sncaip UTSW 18 52898204 missense probably benign 0.28
R5977:Sncaip UTSW 18 52869321 missense probably benign
R6197:Sncaip UTSW 18 52906894 missense probably damaging 1.00
R6505:Sncaip UTSW 18 52906537 nonsense probably null
R6604:Sncaip UTSW 18 52905846 missense possibly damaging 0.71
R6880:Sncaip UTSW 18 52869064 missense probably damaging 1.00
R7215:Sncaip UTSW 18 52907343 nonsense probably null
R7234:Sncaip UTSW 18 52915344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCATGGAGACCTACTGTGAAC -3'
(R):5'- TGTCGAGGTCATAGTGCTCCAG -3'

Sequencing Primer
(F):5'- TGGAGACCTACTGTGAACATAAC -3'
(R):5'- GTCATAGTGCTCCAGCTCGC -3'
Posted On2018-04-27