Incidental Mutation 'R6335:Crocc2'
ID512883
Institutional Source Beutler Lab
Gene Symbol Crocc2
Ensembl Gene ENSMUSG00000084989
Gene Nameciliary rootlet coiled-coil, rootletin family member 2
SynonymsLOC381284, E030010N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6335 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93168725-93231072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93202838 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 947 (Q947L)
Ref Sequence ENSEMBL: ENSMUSP00000120588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138595]
Predicted Effect probably benign
Transcript: ENSMUST00000138595
AA Change: Q947L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000120588
Gene: ENSMUSG00000084989
AA Change: Q947L

DomainStartEndE-ValueType
low complexity region 67 82 N/A INTRINSIC
Pfam:Rootletin 89 260 5.1e-24 PFAM
coiled coil region 281 346 N/A INTRINSIC
internal_repeat_1 381 424 9.68e-9 PROSPERO
internal_repeat_3 389 414 5.46e-6 PROSPERO
internal_repeat_4 398 425 1.1e-5 PROSPERO
coiled coil region 426 627 N/A INTRINSIC
coiled coil region 655 1247 N/A INTRINSIC
internal_repeat_2 1252 1280 6.61e-7 PROSPERO
internal_repeat_4 1341 1374 1.1e-5 PROSPERO
internal_repeat_1 1347 1384 9.68e-9 PROSPERO
coiled coil region 1403 1512 N/A INTRINSIC
coiled coil region 1539 1582 N/A INTRINSIC
low complexity region 1590 1604 N/A INTRINSIC
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Cep192 T A 18: 67,834,713 I756N probably damaging Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Napa G T 7: 16,115,637 S258I probably benign Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rexo1 A T 10: 80,544,081 Y23N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Sptbn5 C A 2: 120,054,419 probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Vmn1r196 T A 13: 22,293,717 S175R probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Crocc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Crocc2 APN 1 93217044 nonsense probably null
R0396:Crocc2 UTSW 1 93224214 splice site probably benign
R1382:Crocc2 UTSW 1 93217093 critical splice donor site probably null
R4608:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4609:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4619:Crocc2 UTSW 1 93213650 missense probably benign
R4646:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4647:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4648:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4767:Crocc2 UTSW 1 93202856 missense possibly damaging 0.72
R4811:Crocc2 UTSW 1 93205896 missense probably damaging 0.99
R5046:Crocc2 UTSW 1 93205902 missense probably damaging 0.96
R5389:Crocc2 UTSW 1 93215641 missense probably benign 0.03
R5632:Crocc2 UTSW 1 93217853 missense probably damaging 0.98
R5887:Crocc2 UTSW 1 93194116 missense possibly damaging 0.47
R6128:Crocc2 UTSW 1 93194401 missense probably benign 0.28
R6142:Crocc2 UTSW 1 93190479 missense possibly damaging 0.61
R6258:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6260:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6288:Crocc2 UTSW 1 93194505 missense probably benign 0.07
R6312:Crocc2 UTSW 1 93215710 nonsense probably null
R6339:Crocc2 UTSW 1 93214032 missense probably benign 0.23
R6371:Crocc2 UTSW 1 93215631 missense probably benign 0.10
R6439:Crocc2 UTSW 1 93183404 missense possibly damaging 0.81
R6442:Crocc2 UTSW 1 93185053 missense probably benign 0.38
R6545:Crocc2 UTSW 1 93212937 missense probably benign 0.45
R6619:Crocc2 UTSW 1 93190501 missense probably benign 0.09
R6898:Crocc2 UTSW 1 93215582 missense probably benign 0.06
R7170:Crocc2 UTSW 1 93193982 missense possibly damaging 0.95
R7378:Crocc2 UTSW 1 93194087 missense probably damaging 0.98
R7395:Crocc2 UTSW 1 93216107 nonsense probably null
R7461:Crocc2 UTSW 1 93194589 missense possibly damaging 0.47
R7613:Crocc2 UTSW 1 93194589 missense possibly damaging 0.47
R7831:Crocc2 UTSW 1 93215473 missense probably benign 0.17
R7914:Crocc2 UTSW 1 93215473 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGTTTAATTCAGAGCCTCCAGC -3'
(R):5'- ATGACTGGTATATGGGCATGTGAC -3'

Sequencing Primer
(F):5'- TCCAGCGCCAACCAGTCTC -3'
(R):5'- GTGGATGTCTGTTCACCAGCATTC -3'
Posted On2018-04-27