Incidental Mutation 'R6335:Sptbn5'
ID512890
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Namespectrin beta, non-erythrocytic 5
SynonymsEG640524, Spnb5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6335 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120046157-120085772 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 120054419 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000125737
SMART Domains Protein: ENSMUSP00000115497
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
Blast:SPEC 2 28 6e-8 BLAST
SPEC 34 128 2.43e-3 SMART
SPEC 134 234 9.38e-19 SMART
Blast:SPEC 240 280 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Cep192 T A 18: 67,834,713 I756N probably damaging Het
Crocc2 A T 1: 93,202,838 Q947L probably benign Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Napa G T 7: 16,115,637 S258I probably benign Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rexo1 A T 10: 80,544,081 Y23N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Vmn1r196 T A 13: 22,293,717 S175R probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 120054467 unclassified probably benign
IGL01552:Sptbn5 APN 2 120054422 unclassified probably benign
IGL01800:Sptbn5 APN 2 120056427 unclassified probably benign
IGL02156:Sptbn5 APN 2 120047617 unclassified probably benign
R0020:Sptbn5 UTSW 2 120065631 missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 120062675 unclassified probably null
R1121:Sptbn5 UTSW 2 120069390 unclassified probably null
R1223:Sptbn5 UTSW 2 120072044 missense probably damaging 0.99
R1405:Sptbn5 UTSW 2 120050616 splice site noncoding transcript
R1852:Sptbn5 UTSW 2 120071644 missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 120070462 missense probably benign 0.00
R2570:Sptbn5 UTSW 2 120048640 exon noncoding transcript
R3898:Sptbn5 UTSW 2 120057210 exon noncoding transcript
R3976:Sptbn5 UTSW 2 120048261 splice site noncoding transcript
R4092:Sptbn5 UTSW 2 120067051 missense probably damaging 0.99
R4119:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4120:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4352:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4364:Sptbn5 UTSW 2 120068655 missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 120065994 missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 120067446 unclassified probably null
R4616:Sptbn5 UTSW 2 120048757 exon noncoding transcript
R4687:Sptbn5 UTSW 2 120077208 unclassified probably benign
R4693:Sptbn5 UTSW 2 120059416 unclassified probably benign
R4762:Sptbn5 UTSW 2 120077222 unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 120059141 unclassified probably benign
R4818:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4822:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4825:Sptbn5 UTSW 2 120055893 unclassified probably benign
R4933:Sptbn5 UTSW 2 120050120 exon noncoding transcript
R4970:Sptbn5 UTSW 2 120051777 exon noncoding transcript
R5141:Sptbn5 UTSW 2 120061731 missense probably benign 0.03
R5209:Sptbn5 UTSW 2 120072002 missense probably benign 0.09
R5225:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5227:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5421:Sptbn5 UTSW 2 120080780 critical splice donor site noncoding transcript
R5495:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5498:Sptbn5 UTSW 2 120076638 unclassified probably benign
R5511:Sptbn5 UTSW 2 120059721 unclassified probably benign
R5596:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5616:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5617:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5619:Sptbn5 UTSW 2 120050132 exon noncoding transcript
R5625:Sptbn5 UTSW 2 120079792 exon noncoding transcript
R5636:Sptbn5 UTSW 2 120057404 unclassified probably benign
R5646:Sptbn5 UTSW 2 120048811 splice site noncoding transcript
R5666:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5670:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5715:Sptbn5 UTSW 2 120072504 missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 120050458 exon noncoding transcript
R5885:Sptbn5 UTSW 2 120076663 unclassified probably benign
R6016:Sptbn5 UTSW 2 120050092 exon noncoding transcript
R6183:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6184:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6219:Sptbn5 UTSW 2 120077322 unclassified probably benign
R6383:Sptbn5 UTSW 2 120046269 unclassified probably benign
R6450:Sptbn5 UTSW 2 120047135 unclassified probably benign
R6516:Sptbn5 UTSW 2 120047950 unclassified probably benign
R6523:Sptbn5 UTSW 2 120065614 unclassified probably null
R6657:Sptbn5 UTSW 2 120076400 unclassified probably benign
R6661:Sptbn5 UTSW 2 120072375 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACCTGACCCCTAGACTTTGG -3'
(R):5'- AGCCATAGTTAGCCTTGTGGG -3'

Sequencing Primer
(F):5'- CTGACCCCTAGACTTTGGAAGAG -3'
(R):5'- GCCTTGTGGGGTTTAAATAATACCC -3'
Posted On2018-04-27