Incidental Mutation 'R6335:Cdk5rap2'
ID 512898
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 044489-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R6335 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 70184849 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1200 (D1200E)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144099
AA Change: D1200E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: D1200E

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,909,481 (GRCm39) probably null Het
Best3 G T 10: 116,838,556 (GRCm39) V205F probably benign Het
C1qtnf1 A G 11: 118,338,960 (GRCm39) H210R probably damaging Het
Camkv T C 9: 107,823,894 (GRCm39) probably null Het
Cep192 T A 18: 67,967,784 (GRCm39) I756N probably damaging Het
Crocc2 A T 1: 93,130,560 (GRCm39) Q947L probably benign Het
Dcaf1 A G 9: 106,715,845 (GRCm39) T321A possibly damaging Het
Dgkz T C 2: 91,774,724 (GRCm39) M87V probably benign Het
Dmrt2 T A 19: 25,650,935 (GRCm39) S40R possibly damaging Het
Dpep1 T G 8: 123,927,391 (GRCm39) L315R probably damaging Het
Fam221b G T 4: 43,665,942 (GRCm39) T223N possibly damaging Het
Fasn A T 11: 120,706,185 (GRCm39) V1053E probably damaging Het
Galc T C 12: 98,208,973 (GRCm39) D227G probably damaging Het
Grik1 A G 16: 87,744,794 (GRCm39) L486P probably damaging Het
Grik5 A G 7: 24,713,019 (GRCm39) S836P probably benign Het
Grpel2 T C 18: 61,852,792 (GRCm39) K70R possibly damaging Het
Ipo7 A G 7: 109,617,675 (GRCm39) D15G possibly damaging Het
Iqgap1 A G 7: 80,377,772 (GRCm39) Y1284H probably damaging Het
Lmo7 T C 14: 102,138,072 (GRCm39) S692P probably damaging Het
Mecom A G 3: 30,034,905 (GRCm39) L447P probably damaging Het
Mtor A G 4: 148,550,384 (GRCm39) D680G probably damaging Het
Muc16 T A 9: 18,572,004 (GRCm39) I172F unknown Het
Musk A G 4: 58,366,811 (GRCm39) I476M probably benign Het
Myef2 T C 2: 124,951,632 (GRCm39) T268A probably damaging Het
Naip1 A G 13: 100,563,060 (GRCm39) S702P probably damaging Het
Napa G T 7: 15,849,562 (GRCm39) S258I probably benign Het
Nfasc T A 1: 132,504,132 (GRCm39) I1039F probably damaging Het
Nlrc5 A G 8: 95,228,902 (GRCm39) S1238G probably benign Het
Or10q12 T C 19: 13,746,144 (GRCm39) V146A probably benign Het
Or1j12 A G 2: 36,342,734 (GRCm39) I46V probably benign Het
Or5w8 T A 2: 87,687,811 (GRCm39) C97* probably null Het
Pacs1 G T 19: 5,210,005 (GRCm39) N215K probably damaging Het
Parp10 A G 15: 76,126,388 (GRCm39) S267P probably benign Het
Pbrm1 G T 14: 30,806,052 (GRCm39) C995F probably damaging Het
Pcdh7 A T 5: 58,099,607 (GRCm39) probably null Het
Ppef2 T C 5: 92,383,613 (GRCm39) Y499C probably damaging Het
Pramel16 G T 4: 143,675,602 (GRCm39) T408K probably benign Het
Prex2 A C 1: 11,180,544 (GRCm39) I370L probably benign Het
Ptprd A G 4: 75,872,420 (GRCm39) Y1350H probably damaging Het
Rasgrp1 T C 2: 117,124,351 (GRCm39) K284E probably damaging Het
Rexo1 A T 10: 80,379,915 (GRCm39) Y23N probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Sash3 C T X: 47,248,398 (GRCm39) L307F probably damaging Homo
Scn9a T A 2: 66,398,608 (GRCm39) M1L possibly damaging Het
Serpinb6e C A 13: 34,021,805 (GRCm39) L174F probably benign Het
Siae C T 9: 37,544,277 (GRCm39) T275I probably benign Het
Sptbn5 C A 2: 119,884,900 (GRCm39) probably benign Het
Ss18l2 C T 9: 121,541,672 (GRCm39) T55I probably damaging Het
Taf1c A G 8: 120,328,518 (GRCm39) C163R probably damaging Het
Tanc2 C T 11: 105,748,382 (GRCm39) R505W probably damaging Het
Tango6 C A 8: 107,419,308 (GRCm39) P285Q possibly damaging Het
Tdrd9 G T 12: 112,008,186 (GRCm39) probably null Het
Tead3 A T 17: 28,552,299 (GRCm39) L307H probably damaging Het
Ticrr A C 7: 79,344,031 (GRCm39) probably null Het
Trpc4 T C 3: 54,224,995 (GRCm39) probably null Het
Upb1 A T 10: 75,264,135 (GRCm39) T194S probably benign Het
Vav3 A G 3: 109,470,512 (GRCm39) N566S probably benign Het
Vmn1r196 T A 13: 22,477,887 (GRCm39) S175R probably benign Het
Zscan29 T C 2: 120,991,917 (GRCm39) N589D possibly damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAACCTGCAAGCCTAATG -3'
(R):5'- TGGAAGGCTACCGGAACATC -3'

Sequencing Primer
(F):5'- CTAATGAGGAGGATGAAGCAGG -3'
(R):5'- GGAACATCATTGTCCAGCTACTG -3'
Posted On 2018-04-27