Mutagenetix > Incidental Mutation

Incidental Mutation 'R6335:Cdk5rap2'

512898

Institutional Source

Beutler Lab

Gene Symbol

Cdk5rap2

Ensembl Gene

ENSMUSG00000039298

Gene Name

CDK5 regulatory subunit associated protein 2

Synonyms

2900018K03Rik, an

MMRRC Submission

Accession Numbers

Genbank: NM_145990.3

Essential gene?

Possibly non essential (E-score: 0.428) question?

Stock #

R6335 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70216856-70410443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 70266612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1200 (D1200E)

Ref Sequence

ENSEMBL: ENSMUSP00000119891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]

AlphaFold

Q8K389

Predicted Effect

probably benign
Transcript: ENSMUST00000076541

Predicted Effect

probably benign
Transcript: ENSMUST00000138561

SMART Domains

Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

Domain	Start	End	E-Value	Type
Blast:BRLZ	228	284	1e-13	BLAST
low complexity region	297	314	N/A	INTRINSIC
low complexity region	368	386	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144099
AA Change: D1200E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: D1200E

Domain	Start	End	E-Value	Type
Pfam:Cnn_1N	58	130	3.6e-26	PFAM
coiled coil region	210	345	N/A	INTRINSIC
low complexity region	368	381	N/A	INTRINSIC
coiled coil region	388	462	N/A	INTRINSIC
coiled coil region	569	616	N/A	INTRINSIC
low complexity region	761	776	N/A	INTRINSIC
low complexity region	791	800	N/A	INTRINSIC
coiled coil region	960	1001	N/A	INTRINSIC
coiled coil region	1112	1140	N/A	INTRINSIC
coiled coil region	1200	1237	N/A	INTRINSIC
Blast:BRLZ	1479	1535	6e-13	BLAST
low complexity region	1548	1565	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
low complexity region	1811	1822	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp11a	T	C	8: 12,859,481		probably null	Het
Best3	G	T	10: 117,002,651	V205F	probably benign	Het
C1qtnf1	A	G	11: 118,448,134	H210R	probably damaging	Het
Camkv	T	C	9: 107,946,695		probably null	Het
Cep192	T	A	18: 67,834,713	I756N	probably damaging	Het
Crocc2	A	T	1: 93,202,838	Q947L	probably benign	Het
Dcaf1	A	G	9: 106,838,646	T321A	possibly damaging	Het
Dgkz	T	C	2: 91,944,379	M87V	probably benign	Het
Dmrt2	T	A	19: 25,673,571	S40R	possibly damaging	Het
Dpep1	T	G	8: 123,200,652	L315R	probably damaging	Het
Fam221b	G	T	4: 43,665,942	T223N	possibly damaging	Het
Fasn	A	T	11: 120,815,359	V1053E	probably damaging	Het
Galc	T	C	12: 98,242,714	D227G	probably damaging	Het
Grik1	A	G	16: 87,947,906	L486P	probably damaging	Het
Grik5	A	G	7: 25,013,594	S836P	probably benign	Het
Grpel2	T	C	18: 61,719,721	K70R	possibly damaging	Het
Ipo7	A	G	7: 110,018,468	D15G	possibly damaging	Het
Iqgap1	A	G	7: 80,728,024	Y1284H	probably damaging	Het
Lmo7	T	C	14: 101,900,636	S692P	probably damaging	Het
Mecom	A	G	3: 29,980,756	L447P	probably damaging	Het
Mtor	A	G	4: 148,465,927	D680G	probably damaging	Het
Muc16	T	A	9: 18,660,708	I172F	unknown	Het
Musk	A	G	4: 58,366,811	I476M	probably benign	Het
Myef2	T	C	2: 125,109,712	T268A	probably damaging	Het
Naip1	A	G	13: 100,426,552	S702P	probably damaging	Het
Napa	G	T	7: 16,115,637	S258I	probably benign	Het
Nfasc	T	A	1: 132,576,394	I1039F	probably damaging	Het
Nlrc5	A	G	8: 94,502,274	S1238G	probably benign	Het
Olfr1151	T	A	2: 87,857,467	C97*	probably null	Het
Olfr1495	T	C	19: 13,768,780	V146A	probably benign	Het
Olfr340	A	G	2: 36,452,722	I46V	probably benign	Het
Pacs1	G	T	19: 5,159,977	N215K	probably damaging	Het
Parp10	A	G	15: 76,242,188	S267P	probably benign	Het
Pbrm1	G	T	14: 31,084,095	C995F	probably damaging	Het
Pcdh7	A	T	5: 57,942,265		probably null	Het
Ppef2	T	C	5: 92,235,754	Y499C	probably damaging	Het
Pramef25	G	T	4: 143,949,032	T408K	probably benign	Het
Prex2	A	C	1: 11,110,320	I370L	probably benign	Het
Ptprd	A	G	4: 75,954,183	Y1350H	probably damaging	Het
Rasgrp1	T	C	2: 117,293,870	K284E	probably damaging	Het
Rexo1	A	T	10: 80,544,081	Y23N	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sash3	C	T	X: 48,159,521	L307F	probably damaging	Homo
Scn9a	T	A	2: 66,568,264	M1L	possibly damaging	Het
Serpinb6e	C	A	13: 33,837,822	L174F	probably benign	Het
Siae	C	T	9: 37,632,981	T275I	probably benign	Het
Sptbn5	C	A	2: 120,054,419		probably benign	Het
Ss18l2	C	T	9: 121,712,606	T55I	probably damaging	Het
Taf1c	A	G	8: 119,601,779	C163R	probably damaging	Het
Tanc2	C	T	11: 105,857,556	R505W	probably damaging	Het
Tango6	C	A	8: 106,692,676	P285Q	possibly damaging	Het
Tdrd9	G	T	12: 112,041,752		probably null	Het
Tead3	A	T	17: 28,333,325	L307H	probably damaging	Het
Ticrr	A	C	7: 79,694,283		probably null	Het
Trpc4	T	C	3: 54,317,574		probably null	Het
Upb1	A	T	10: 75,428,301	T194S	probably benign	Het
Vav3	A	G	3: 109,563,196	N566S	probably benign	Het
Vmn1r196	T	A	13: 22,293,717	S175R	probably benign	Het
Zscan29	T	C	2: 121,161,436	N589D	possibly damaging	Het

Other mutations in Cdk5rap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cdk5rap2	APN	4	70403472	critical splice donor site	probably null
IGL01305:Cdk5rap2	APN	4	70380235	missense	possibly damaging	0.52
IGL01987:Cdk5rap2	APN	4	70302082	critical splice donor site	probably null
IGL02213:Cdk5rap2	APN	4	70317602	splice site	probably benign
IGL02732:Cdk5rap2	APN	4	70266665	nonsense	probably null
IGL03063:Cdk5rap2	APN	4	70354877	critical splice acceptor site	probably null
IGL03244:Cdk5rap2	APN	4	70281435	missense	probably benign	0.19
ANU22:Cdk5rap2	UTSW	4	70380235	missense	possibly damaging	0.52
F5426:Cdk5rap2	UTSW	4	70254803	missense	probably benign
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0482:Cdk5rap2	UTSW	4	70410269	start gained	probably benign
R0548:Cdk5rap2	UTSW	4	70349142	critical splice donor site	probably null
R0594:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R0737:Cdk5rap2	UTSW	4	70337375	missense	probably benign	0.01
R0788:Cdk5rap2	UTSW	4	70307231	missense	possibly damaging	0.90
R0960:Cdk5rap2	UTSW	4	70243508	missense	probably benign	0.03
R1682:Cdk5rap2	UTSW	4	70302150	missense	possibly damaging	0.92
R1727:Cdk5rap2	UTSW	4	70272679	missense	probably benign
R1727:Cdk5rap2	UTSW	4	70289972	missense	possibly damaging	0.70
R1768:Cdk5rap2	UTSW	4	70307233	missense	probably benign	0.09
R1903:Cdk5rap2	UTSW	4	70403554	splice site	probably null
R2270:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2271:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2272:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2364:Cdk5rap2	UTSW	4	70360809	critical splice donor site	probably null
R2763:Cdk5rap2	UTSW	4	70281271	missense	probably benign
R2893:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2894:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2958:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2959:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2961:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2962:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2963:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3522:Cdk5rap2	UTSW	4	70250410	missense	probably damaging	1.00
R3725:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3726:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3876:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3919:Cdk5rap2	UTSW	4	70380223	missense	possibly damaging	0.50
R4025:Cdk5rap2	UTSW	4	70250387	missense	probably damaging	0.98
R4324:Cdk5rap2	UTSW	4	70353614	missense	probably damaging	1.00
R4485:Cdk5rap2	UTSW	4	70239283	critical splice donor site	probably null
R4516:Cdk5rap2	UTSW	4	70276715	splice site	probably null
R4556:Cdk5rap2	UTSW	4	70239312	missense	probably damaging	0.97
R4560:Cdk5rap2	UTSW	4	70315331	missense	probably benign	0.03
R4584:Cdk5rap2	UTSW	4	70266760	missense	probably damaging	1.00
R4620:Cdk5rap2	UTSW	4	70266706	missense	probably benign	0.00
R4639:Cdk5rap2	UTSW	4	70302176	missense	probably damaging	0.97
R4755:Cdk5rap2	UTSW	4	70238425	missense	probably damaging	1.00
R4947:Cdk5rap2	UTSW	4	70228592	splice site	probably null
R5116:Cdk5rap2	UTSW	4	70307238	missense	possibly damaging	0.67
R5449:Cdk5rap2	UTSW	4	70276651	missense	probably benign	0.00
R5643:Cdk5rap2	UTSW	4	70266733	missense	probably damaging	0.99
R5899:Cdk5rap2	UTSW	4	70243593	splice site	probably benign
R6177:Cdk5rap2	UTSW	4	70281482	missense	probably damaging	0.99
R6254:Cdk5rap2	UTSW	4	70364032	missense	probably damaging	1.00
R6326:Cdk5rap2	UTSW	4	70235454	missense	probably damaging	1.00
R6534:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R6857:Cdk5rap2	UTSW	4	70245396	nonsense	probably null
R6959:Cdk5rap2	UTSW	4	70360669	splice site	probably null
R7104:Cdk5rap2	UTSW	4	70349156	missense	probably benign	0.00
R7145:Cdk5rap2	UTSW	4	70238231	missense	probably benign	0.13
R7223:Cdk5rap2	UTSW	4	70235447	missense	probably benign	0.02
R7234:Cdk5rap2	UTSW	4	70376787	splice site	probably null
R7240:Cdk5rap2	UTSW	4	70291908	missense	probably damaging	1.00
R7247:Cdk5rap2	UTSW	4	70337429	missense	probably damaging	1.00
R7382:Cdk5rap2	UTSW	4	70290025	missense	probably benign	0.19
R7413:Cdk5rap2	UTSW	4	70254735	missense	probably damaging	1.00
R7576:Cdk5rap2	UTSW	4	70266872	missense	probably benign	0.01
R8236:Cdk5rap2	UTSW	4	70242485	missense	probably benign
R8434:Cdk5rap2	UTSW	4	70364020	missense	probably benign	0.00
R8688:Cdk5rap2	UTSW	4	70380273	missense	probably damaging	1.00
R8706:Cdk5rap2	UTSW	4	70239325	missense	probably benign	0.08
R8731:Cdk5rap2	UTSW	4	70245510	splice site	probably benign
R8782:Cdk5rap2	UTSW	4	70243475	missense	possibly damaging	0.57
R8855:Cdk5rap2	UTSW	4	70300650	missense	probably damaging	1.00
R8965:Cdk5rap2	UTSW	4	70266805	missense	probably benign	0.30
R9242:Cdk5rap2	UTSW	4	70337346	missense	possibly damaging	0.46
R9308:Cdk5rap2	UTSW	4	70410267	start codon destroyed	probably null	0.99
R9396:Cdk5rap2	UTSW	4	70254666	missense	possibly damaging	0.75
R9396:Cdk5rap2	UTSW	4	70264658	missense	probably damaging	0.97
R9507:Cdk5rap2	UTSW	4	70291873	missense	probably benign
Z1176:Cdk5rap2	UTSW	4	70266743	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAAACCTGCAAGCCTAATG -3'
(R):5'- TGGAAGGCTACCGGAACATC -3'

Sequencing Primer
(F):5'- CTAATGAGGAGGATGAAGCAGG -3'
(R):5'- GGAACATCATTGTCCAGCTACTG -3'

Posted On

2018-04-27