Incidental Mutation 'R6335:Napa'
ID512903
Institutional Source Beutler Lab
Gene Symbol Napa
Ensembl Gene ENSMUSG00000006024
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein alpha
SynonymsSNAPA, SNARE, 1500039N14Rik, a-SNAP, RA81, hyh
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6335 (G1)
Quality Score210.009
Status Validated
Chromosome7
Chromosomal Location16098458-16117975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16115637 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 258 (S258I)
Ref Sequence ENSEMBL: ENSMUSP00000006181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006178] [ENSMUST00000006181] [ENSMUST00000127637]
Predicted Effect probably benign
Transcript: ENSMUST00000006178
SMART Domains Protein: ENSMUSP00000006178
Gene: ENSMUSG00000006021

DomainStartEndE-ValueType
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000006181
AA Change: S258I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000006181
Gene: ENSMUSG00000006024
AA Change: S258I

DomainStartEndE-ValueType
Pfam:SNAP 8 288 4.5e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124563
Predicted Effect probably benign
Transcript: ENSMUST00000127637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152044
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: The homozygous null mutation is embryonic lethal while partial loss of function homozygous mutants develop hydrocephalus and die postnatally. These mutants also display central nervous system abnormalities and impaired motor capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Cep192 T A 18: 67,834,713 I756N probably damaging Het
Crocc2 A T 1: 93,202,838 Q947L probably benign Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rexo1 A T 10: 80,544,081 Y23N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Sptbn5 C A 2: 120,054,419 probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Vmn1r196 T A 13: 22,293,717 S175R probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Napa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Napa APN 7 16098744 missense possibly damaging 0.66
IGL02383:Napa APN 7 16112578 splice site probably benign
IGL02968:Napa APN 7 16113341 splice site probably benign
R0782:Napa UTSW 7 16115267 missense probably benign 0.00
R2067:Napa UTSW 7 16115278 unclassified probably benign
R2115:Napa UTSW 7 16114209 missense possibly damaging 0.91
R2360:Napa UTSW 7 16114158 missense probably damaging 1.00
R4762:Napa UTSW 7 16115271 missense probably benign 0.22
R5386:Napa UTSW 7 16116472 missense probably benign 0.01
R5503:Napa UTSW 7 16115624 missense probably benign 0.07
R6939:Napa UTSW 7 16115257 missense possibly damaging 0.94
R6961:Napa UTSW 7 16109109 nonsense probably null
R7841:Napa UTSW 7 16115634 missense possibly damaging 0.94
R7924:Napa UTSW 7 16115634 missense possibly damaging 0.94
X0025:Napa UTSW 7 16115212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTACAGTTAACGCAGGGACC -3'
(R):5'- TCAAGTAGGGCAGAGTCTTTTG -3'

Sequencing Primer
(F):5'- TTAACGCAGGGACCGTGGAG -3'
(R):5'- AACTTGTTCTGTAGACCAGGCTGAC -3'
Posted On2018-04-27