Incidental Mutation 'R6335:Rexo1'
ID512919
Institutional Source Beutler Lab
Gene Symbol Rexo1
Ensembl Gene ENSMUSG00000047417
Gene NameREX1, RNA exonuclease 1
Synonyms2610511M11Rik, Tceb3bp1, 1700021P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R6335 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80540922-80561560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80544081 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 23 (Y23N)
Ref Sequence ENSEMBL: ENSMUSP00000138616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000057910] [ENSMUST00000183160] [ENSMUST00000219648] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057910
AA Change: Y972N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: Y972N

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182260
AA Change: Y294N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182682
Predicted Effect probably benign
Transcript: ENSMUST00000183073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183139
Predicted Effect probably damaging
Transcript: ENSMUST00000183160
AA Change: Y23N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183233
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Cep192 T A 18: 67,834,713 I756N probably damaging Het
Crocc2 A T 1: 93,202,838 Q947L probably benign Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Napa G T 7: 16,115,637 S258I probably benign Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Sptbn5 C A 2: 120,054,419 probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Vmn1r196 T A 13: 22,293,717 S175R probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Rexo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Rexo1 APN 10 80550964 missense probably damaging 0.99
IGL01128:Rexo1 APN 10 80549739 missense probably benign
IGL01890:Rexo1 APN 10 80543011 missense possibly damaging 0.85
PIT4453001:Rexo1 UTSW 10 80550397 missense probably damaging 0.97
R0044:Rexo1 UTSW 10 80544378 missense probably benign 0.16
R0365:Rexo1 UTSW 10 80542576 missense probably damaging 0.99
R0573:Rexo1 UTSW 10 80544850 missense probably damaging 1.00
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1511:Rexo1 UTSW 10 80550050 missense possibly damaging 0.93
R1523:Rexo1 UTSW 10 80542751 missense probably benign 0.41
R1807:Rexo1 UTSW 10 80542579 missense possibly damaging 0.95
R1868:Rexo1 UTSW 10 80542920 missense probably damaging 1.00
R1935:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1936:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1957:Rexo1 UTSW 10 80543366 missense probably damaging 0.96
R2084:Rexo1 UTSW 10 80561266 missense probably benign 0.01
R2153:Rexo1 UTSW 10 80544109 nonsense probably null
R2262:Rexo1 UTSW 10 80549569 missense probably benign 0.02
R4471:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4472:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4690:Rexo1 UTSW 10 80546421 missense probably benign 0.01
R4972:Rexo1 UTSW 10 80549693 missense probably damaging 0.96
R6505:Rexo1 UTSW 10 80543011 missense possibly damaging 0.85
R6615:Rexo1 UTSW 10 80544014 missense possibly damaging 0.68
R6949:Rexo1 UTSW 10 80550636 missense possibly damaging 0.46
R7612:Rexo1 UTSW 10 80549663 missense probably benign 0.40
R7807:Rexo1 UTSW 10 80550136 missense probably benign 0.09
R7840:Rexo1 UTSW 10 80550738 missense probably benign
R8779:Rexo1 UTSW 10 80548458 missense probably benign 0.26
Z1177:Rexo1 UTSW 10 80549775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATTACACAGGGCCAGAGC -3'
(R):5'- ATCTTCACAGCCGAGGAGAAG -3'

Sequencing Primer
(F):5'- TTACACAGGGCCAGAGCTTCAG -3'
(R):5'- AAGGACCGTGAGTATCCTCC -3'
Posted On2018-04-27