Incidental Mutation 'R6335:Vmn1r196'
ID512927
Institutional Source Beutler Lab
Gene Symbol Vmn1r196
Ensembl Gene ENSMUSG00000069295
Gene Namevomeronasal 1 receptor 196
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6335 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location22289920-22298360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22293717 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 175 (S175R)
Ref Sequence ENSEMBL: ENSMUSP00000154145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091735] [ENSMUST00000226245] [ENSMUST00000227516] [ENSMUST00000228382] [ENSMUST00000228557]
Predicted Effect probably benign
Transcript: ENSMUST00000091735
AA Change: S175R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089329
Gene: ENSMUSG00000069295
AA Change: S175R

DomainStartEndE-ValueType
Pfam:V1R 35 297 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120610
Predicted Effect probably benign
Transcript: ENSMUST00000226245
AA Change: S98R

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227516
Predicted Effect probably benign
Transcript: ENSMUST00000228382
AA Change: S175R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000228557
AA Change: S175R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Cep192 T A 18: 67,834,713 I756N probably damaging Het
Crocc2 A T 1: 93,202,838 Q947L probably benign Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Napa G T 7: 16,115,637 S258I probably benign Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rexo1 A T 10: 80,544,081 Y23N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Sptbn5 C A 2: 120,054,419 probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Vmn1r196
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Vmn1r196 APN 13 22293699 nonsense probably null
R0415:Vmn1r196 UTSW 13 22293836 missense probably damaging 1.00
R0502:Vmn1r196 UTSW 13 22293387 missense probably benign 0.01
R0503:Vmn1r196 UTSW 13 22293387 missense probably benign 0.01
R2306:Vmn1r196 UTSW 13 22293303 missense probably benign 0.08
R4463:Vmn1r196 UTSW 13 22293683 missense probably benign
R7664:Vmn1r196 UTSW 13 22293762 missense probably damaging 1.00
R8062:Vmn1r196 UTSW 13 22293270 missense probably damaging 1.00
S24628:Vmn1r196 UTSW 13 22293836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGTCCAAGCAGTTATCATG -3'
(R):5'- AGGACACTTTGAGCAGCTCTC -3'

Sequencing Primer
(F):5'- GCAGTTATCATGAGCCCCAGAG -3'
(R):5'- TCTCAGCTCAGGGGGAGTTC -3'
Posted On2018-04-27