Incidental Mutation 'R6335:Cep192'
ID512936
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Namecentrosomal protein 192
Synonyms4631422C13Rik, D430014P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6335 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location67800107-67885170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67834713 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 756 (I756N)
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
Predicted Effect probably damaging
Transcript: ENSMUST00000025425
AA Change: I756N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542
AA Change: I756N

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225077
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Crocc2 A T 1: 93,202,838 Q947L probably benign Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Napa G T 7: 16,115,637 S258I probably benign Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rexo1 A T 10: 80,544,081 Y23N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Sptbn5 C A 2: 120,054,419 probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Vmn1r196 T A 13: 22,293,717 S175R probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67820336 missense probably damaging 1.00
IGL00163:Cep192 APN 18 67880800 missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67858868 missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67812406 missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67804375 missense probably damaging 0.97
IGL01302:Cep192 APN 18 67858903 missense probably benign 0.03
IGL01653:Cep192 APN 18 67852972 missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67803137 missense possibly damaging 0.83
IGL02448:Cep192 APN 18 67869447 missense probably benign 0.25
IGL02494:Cep192 APN 18 67804383 missense probably benign 0.00
IGL02574:Cep192 APN 18 67841279 missense probably damaging 0.99
IGL02624:Cep192 APN 18 67880795 missense probably benign 0.20
IGL02646:Cep192 APN 18 67862477 missense probably damaging 1.00
IGL02652:Cep192 APN 18 67858850 splice site probably benign
IGL02684:Cep192 APN 18 67834563 missense probably damaging 0.99
IGL02977:Cep192 APN 18 67852905 missense probably damaging 0.97
IGL03000:Cep192 APN 18 67852044 missense probably damaging 1.00
IGL03133:Cep192 APN 18 67810105 missense probably benign 0.00
IGL03139:Cep192 APN 18 67828476 critical splice donor site probably null
IGL03213:Cep192 APN 18 67865637 missense probably damaging 1.00
IGL03250:Cep192 APN 18 67807355 missense probably benign 0.01
IGL03259:Cep192 APN 18 67820412 missense probably damaging 1.00
R0117:Cep192 UTSW 18 67850737 critical splice donor site probably null
R0180:Cep192 UTSW 18 67835488 missense probably damaging 1.00
R0281:Cep192 UTSW 18 67828482 splice site probably benign
R0374:Cep192 UTSW 18 67818883 nonsense probably null
R0420:Cep192 UTSW 18 67813893 missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67858018 missense probably damaging 1.00
R0652:Cep192 UTSW 18 67807265 missense probably benign 0.04
R1024:Cep192 UTSW 18 67838054 missense probably benign 0.37
R1382:Cep192 UTSW 18 67856299 missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1395:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1641:Cep192 UTSW 18 67847433 missense probably damaging 1.00
R1704:Cep192 UTSW 18 67856256 missense probably damaging 1.00
R1793:Cep192 UTSW 18 67851767 missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67804424 missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67803158 critical splice donor site probably null
R2164:Cep192 UTSW 18 67820360 missense probably damaging 0.99
R2180:Cep192 UTSW 18 67824742 missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67813899 missense probably benign 0.07
R2442:Cep192 UTSW 18 67824688 missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67855270 splice site probably null
R2898:Cep192 UTSW 18 67855270 splice site probably null
R2901:Cep192 UTSW 18 67869441 missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67834892 missense probably benign 0.08
R3620:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3621:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3712:Cep192 UTSW 18 67820329 missense probably benign 0.00
R4559:Cep192 UTSW 18 67871513 missense probably damaging 1.00
R4590:Cep192 UTSW 18 67816791 nonsense probably null
R4591:Cep192 UTSW 18 67834968 missense probably damaging 0.99
R4604:Cep192 UTSW 18 67815922 missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67812369 missense probably benign 0.03
R4725:Cep192 UTSW 18 67816766 missense probably benign
R4738:Cep192 UTSW 18 67884830 nonsense probably null
R4739:Cep192 UTSW 18 67851732 missense probably benign 0.02
R4927:Cep192 UTSW 18 67835124 missense probably benign 0.16
R4948:Cep192 UTSW 18 67816804 missense probably benign 0.00
R5090:Cep192 UTSW 18 67860546 missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67866541 missense probably benign 0.08
R5154:Cep192 UTSW 18 67850684 missense probably damaging 1.00
R5192:Cep192 UTSW 18 67835004 missense probably benign 0.03
R5735:Cep192 UTSW 18 67880795 missense probably benign 0.20
R5812:Cep192 UTSW 18 67851737 missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67815864 missense probably benign 0.01
R5981:Cep192 UTSW 18 67860590 missense probably damaging 1.00
R6131:Cep192 UTSW 18 67837997 missense possibly damaging 0.65
R6849:Cep192 UTSW 18 67812435 missense probably benign 0.00
R6861:Cep192 UTSW 18 67841628 missense probably benign 0.43
R7192:Cep192 UTSW 18 67850528 missense probably damaging 0.99
R7264:Cep192 UTSW 18 67820355 missense probably damaging 1.00
R7397:Cep192 UTSW 18 67856197 missense probably damaging 1.00
R7409:Cep192 UTSW 18 67834803 missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67820363 missense probably damaging 1.00
R7756:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
RF003:Cep192 UTSW 18 67837956 missense probably benign 0.44
X0066:Cep192 UTSW 18 67812449 splice site probably null
Z1176:Cep192 UTSW 18 67881288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACACTGTCTGGTGGTG -3'
(R):5'- TGCTTCCCTTGAATTAGTAGCAC -3'

Sequencing Primer
(F):5'- ACACACTGTCTGGTGGTGAAGATTC -3'
(R):5'- CTTCCCTTGAATTAGTAGCACAAACG -3'
Posted On2018-04-27