Incidental Mutation 'R6354:Cyp4a14'
ID 512948
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 044506-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6354 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115344441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 475 (F475L)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: F475L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: F475L

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Meta Mutation Damage Score 0.7971 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,685,042 (GRCm39) K152E probably benign Het
Adamts20 C A 15: 94,245,691 (GRCm39) C537F probably damaging Het
Apc A T 18: 34,445,581 (GRCm39) T808S probably benign Het
Atad3a A G 4: 155,838,402 (GRCm39) I205T possibly damaging Het
Casz1 G T 4: 149,036,999 (GRCm39) G1754C unknown Het
Ccdc62 C T 5: 124,082,267 (GRCm39) A232V probably damaging Het
Cdc27 C A 11: 104,425,574 (GRCm39) D81Y probably damaging Het
Cep126 A G 9: 8,099,928 (GRCm39) S869P probably damaging Het
Cfap251 C T 5: 123,440,818 (GRCm39) T1125I probably damaging Het
Ciita A T 16: 10,341,610 (GRCm39) K983N probably damaging Het
Cimap1a A G 7: 140,430,527 (GRCm39) probably null Het
Clstn1 A C 4: 149,727,673 (GRCm39) Q523P probably benign Het
Cpb2 T C 14: 75,495,145 (GRCm39) probably null Het
Crybg2 A G 4: 133,818,447 (GRCm39) D1710G probably benign Het
Csmd3 C T 15: 47,744,885 (GRCm39) G1370D probably damaging Het
Cwf19l1 G T 19: 44,115,912 (GRCm39) D172E probably benign Het
Fam98c C T 7: 28,852,272 (GRCm39) V298M probably damaging Het
Gcsh T C 8: 117,710,582 (GRCm39) N127S probably benign Het
Gimap4 T C 6: 48,663,814 (GRCm39) F10S possibly damaging Het
Gm4787 C T 12: 81,424,755 (GRCm39) A468T probably damaging Het
Gm5111 G A 6: 48,567,268 (GRCm39) probably benign Het
Gm7137 C A 10: 77,623,481 (GRCm39) probably benign Het
Inpp1 A G 1: 52,836,224 (GRCm39) S81P probably damaging Het
Iqce T C 5: 140,662,090 (GRCm39) probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,479,217 (GRCm39) probably benign Het
Krtap13 C A 16: 88,548,131 (GRCm39) C119F probably damaging Het
Lama2 G T 10: 27,088,064 (GRCm39) D904E probably damaging Het
Lrrc37a T A 11: 103,355,213 (GRCm39) I2535F unknown Het
Lrrc40 T A 3: 157,766,901 (GRCm39) L452* probably null Het
Meis1 A T 11: 18,966,184 (GRCm39) M63K possibly damaging Het
Mpo T A 11: 87,688,172 (GRCm39) I277N possibly damaging Het
Mtmr11 T A 3: 96,075,992 (GRCm39) F406I probably benign Het
Muc4 T C 16: 32,575,476 (GRCm39) S1411P probably benign Het
Or2y1b A T 11: 49,208,465 (GRCm39) I31F probably damaging Het
Or4c102 T A 2: 88,422,478 (GRCm39) I110N probably damaging Het
Or56a5 G A 7: 104,792,915 (GRCm39) T195I probably benign Het
Phf21a G A 2: 92,179,282 (GRCm39) G298R probably damaging Het
Phldb2 T C 16: 45,645,477 (GRCm39) Y368C probably damaging Het
Pik3cb G T 9: 98,955,696 (GRCm39) T407K probably benign Het
Robo3 A T 9: 37,328,513 (GRCm39) probably benign Het
Sgsm1 T G 5: 113,430,522 (GRCm39) T288P probably damaging Het
Slc5a7 A G 17: 54,584,061 (GRCm39) S410P probably damaging Het
Tmc6 A C 11: 117,665,062 (GRCm39) C404G probably benign Het
Tnrc6c A T 11: 117,640,440 (GRCm39) Q1410L possibly damaging Het
Trak1 A T 9: 121,280,792 (GRCm39) T384S probably null Het
Txlna A T 4: 129,528,205 (GRCm39) L244Q probably damaging Het
Ube3c T C 5: 29,868,581 (GRCm39) F939L probably damaging Het
Vmn2r65 T A 7: 84,589,574 (GRCm39) I781F probably benign Het
Vmn2r72 A G 7: 85,399,747 (GRCm39) probably null Het
Vps36 T C 8: 22,695,771 (GRCm39) S109P probably damaging Het
Wrn T C 8: 33,833,666 (GRCm39) I82M possibly damaging Het
Zbtb49 T C 5: 38,360,903 (GRCm39) R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 (GRCm39) T1011A possibly damaging Het
Zfhx4 T C 3: 5,467,011 (GRCm39) S2390P probably benign Het
Zfp619 C A 7: 39,184,243 (GRCm39) T91K probably benign Het
Zfp644 A G 5: 106,784,619 (GRCm39) S643P probably benign Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGGACACATTGCAGAGAGC -3'
(R):5'- TGATACCATCATGGGGAACCTG -3'

Sequencing Primer
(F):5'- TGGGAATCAAAGAGAAAGCAAAGTAC -3'
(R):5'- AACCTGGATGCCCCTCAG -3'
Posted On 2018-04-27