Incidental Mutation 'R6354:Sgsm1'
ID 512956
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6354 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 113282656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 288 (T288P)
Ref Sequence ENSEMBL: ENSMUSP00000114932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: T288P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: T288P

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112325
AA Change: T288P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: T288P

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147856
Predicted Effect probably damaging
Transcript: ENSMUST00000154248
AA Change: T288P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: T288P

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156340
Meta Mutation Damage Score 0.2943 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,794,216 K152E probably benign Het
Adamts20 C A 15: 94,347,810 C537F probably damaging Het
Apc A T 18: 34,312,528 T808S probably benign Het
Atad3a A G 4: 155,753,945 I205T possibly damaging Het
Casz1 G T 4: 148,952,542 G1754C unknown Het
Ccdc62 C T 5: 123,944,204 A232V probably damaging Het
Cdc27 C A 11: 104,534,748 D81Y probably damaging Het
Cep126 A G 9: 8,099,927 S869P probably damaging Het
Ciita A T 16: 10,523,746 K983N probably damaging Het
Clstn1 A C 4: 149,643,216 Q523P probably benign Het
Cpb2 T C 14: 75,257,705 probably null Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Csmd3 C T 15: 47,881,489 G1370D probably damaging Het
Cwf19l1 G T 19: 44,127,473 D172E probably benign Het
Cyp4a14 A G 4: 115,487,244 F475L probably damaging Het
Fam98c C T 7: 29,152,847 V298M probably damaging Het
Gcsh T C 8: 116,983,843 N127S probably benign Het
Gimap4 T C 6: 48,686,880 F10S possibly damaging Het
Gm4787 C T 12: 81,377,981 A468T probably damaging Het
Gm5111 G A 6: 48,590,334 probably benign Het
Gm7137 C A 10: 77,787,647 probably benign Het
Inpp1 A G 1: 52,797,065 S81P probably damaging Het
Iqce T C 5: 140,676,335 probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap13 C A 16: 88,751,243 C119F probably damaging Het
Lama2 G T 10: 27,212,068 D904E probably damaging Het
Lrrc37a T A 11: 103,464,387 I2535F unknown Het
Lrrc40 T A 3: 158,061,264 L452* probably null Het
Meis1 A T 11: 19,016,184 M63K possibly damaging Het
Mpo T A 11: 87,797,346 I277N possibly damaging Het
Mtmr11 T A 3: 96,168,676 F406I probably benign Het
Muc4 T C 16: 32,754,358 S1411P probably benign Het
Odf3 A G 7: 140,850,614 probably null Het
Olfr10 A T 11: 49,317,638 I31F probably damaging Het
Olfr1189 T A 2: 88,592,134 I110N probably damaging Het
Olfr683 G A 7: 105,143,708 T195I probably benign Het
Phf21a G A 2: 92,348,937 G298R probably damaging Het
Phldb2 T C 16: 45,825,114 Y368C probably damaging Het
Pik3cb G T 9: 99,073,643 T407K probably benign Het
Robo3 A T 9: 37,417,217 probably benign Het
Slc5a7 A G 17: 54,277,033 S410P probably damaging Het
Tmc6 A C 11: 117,774,236 C404G probably benign Het
Tnrc6c A T 11: 117,749,614 Q1410L possibly damaging Het
Trak1 A T 9: 121,451,726 T384S probably null Het
Txlna A T 4: 129,634,412 L244Q probably damaging Het
Ube3c T C 5: 29,663,583 F939L probably damaging Het
Vmn2r65 T A 7: 84,940,366 I781F probably benign Het
Vmn2r72 A G 7: 85,750,539 probably null Het
Vps36 T C 8: 22,205,755 S109P probably damaging Het
Wdr66 C T 5: 123,302,755 T1125I probably damaging Het
Wrn T C 8: 33,343,638 I82M possibly damaging Het
Zbtb49 T C 5: 38,203,559 R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 T1011A possibly damaging Het
Zfhx4 T C 3: 5,401,951 S2390P probably benign Het
Zfp619 C A 7: 39,534,819 T91K probably benign Het
Zfp644 A G 5: 106,636,753 S643P probably benign Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTCCTTCTGAAGCTACAG -3'
(R):5'- ACTGCAGGTGGTTTCTCTGC -3'

Sequencing Primer
(F):5'- TGGGCCAGGTCACCATAAC -3'
(R):5'- CTGCTCGCTGGGCTTATGC -3'
Posted On 2018-04-27