Incidental Mutation 'R6354:Vmn2r72'
ID512965
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6354 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 85750539 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably null
Transcript: ENSMUST00000063425
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,794,216 K152E probably benign Het
Adamts20 C A 15: 94,347,810 C537F probably damaging Het
Apc A T 18: 34,312,528 T808S probably benign Het
Atad3a A G 4: 155,753,945 I205T possibly damaging Het
Casz1 G T 4: 148,952,542 G1754C unknown Het
Ccdc62 C T 5: 123,944,204 A232V probably damaging Het
Cdc27 C A 11: 104,534,748 D81Y probably damaging Het
Cep126 A G 9: 8,099,927 S869P probably damaging Het
Ciita A T 16: 10,523,746 K983N probably damaging Het
Clstn1 A C 4: 149,643,216 Q523P probably benign Het
Cpb2 T C 14: 75,257,705 probably null Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Csmd3 C T 15: 47,881,489 G1370D probably damaging Het
Cwf19l1 G T 19: 44,127,473 D172E probably benign Het
Cyp4a14 A G 4: 115,487,244 F475L probably damaging Het
Fam98c C T 7: 29,152,847 V298M probably damaging Het
Gcsh T C 8: 116,983,843 N127S probably benign Het
Gimap4 T C 6: 48,686,880 F10S possibly damaging Het
Gm4787 C T 12: 81,377,981 A468T probably damaging Het
Gm5111 G A 6: 48,590,334 probably benign Het
Gm7137 C A 10: 77,787,647 probably benign Het
Inpp1 A G 1: 52,797,065 S81P probably damaging Het
Iqce T C 5: 140,676,335 probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap13 C A 16: 88,751,243 C119F probably damaging Het
Lama2 G T 10: 27,212,068 D904E probably damaging Het
Lrrc37a T A 11: 103,464,387 I2535F unknown Het
Lrrc40 T A 3: 158,061,264 L452* probably null Het
Meis1 A T 11: 19,016,184 M63K possibly damaging Het
Mpo T A 11: 87,797,346 I277N possibly damaging Het
Mtmr11 T A 3: 96,168,676 F406I probably benign Het
Muc4 T C 16: 32,754,358 S1411P probably benign Het
Odf3 A G 7: 140,850,614 probably null Het
Olfr10 A T 11: 49,317,638 I31F probably damaging Het
Olfr1189 T A 2: 88,592,134 I110N probably damaging Het
Olfr683 G A 7: 105,143,708 T195I probably benign Het
Phf21a G A 2: 92,348,937 G298R probably damaging Het
Phldb2 T C 16: 45,825,114 Y368C probably damaging Het
Pik3cb G T 9: 99,073,643 T407K probably benign Het
Robo3 A T 9: 37,417,217 probably benign Het
Sgsm1 T G 5: 113,282,656 T288P probably damaging Het
Slc5a7 A G 17: 54,277,033 S410P probably damaging Het
Tmc6 A C 11: 117,774,236 C404G probably benign Het
Tnrc6c A T 11: 117,749,614 Q1410L possibly damaging Het
Trak1 A T 9: 121,451,726 T384S probably null Het
Txlna A T 4: 129,634,412 L244Q probably damaging Het
Ube3c T C 5: 29,663,583 F939L probably damaging Het
Vmn2r65 T A 7: 84,940,366 I781F probably benign Het
Vps36 T C 8: 22,205,755 S109P probably damaging Het
Wdr66 C T 5: 123,302,755 T1125I probably damaging Het
Wrn T C 8: 33,343,638 I82M possibly damaging Het
Zbtb49 T C 5: 38,203,559 R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 T1011A possibly damaging Het
Zfhx4 T C 3: 5,401,951 S2390P probably benign Het
Zfp619 C A 7: 39,534,819 T91K probably benign Het
Zfp644 A G 5: 106,636,753 S643P probably benign Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCATACTAATGTCGACTGTGTC -3'
(R):5'- TTGCCACCATCTAATTGTAAAACGC -3'

Sequencing Primer
(F):5'- AATGTCGACTGTGTCATATTACATG -3'
(R):5'- GTAAAACGCTGAAGAATTGTCCC -3'
Posted On2018-04-27