Incidental Mutation 'R6354:Olfr683'
ID512966
Institutional Source Beutler Lab
Gene Symbol Olfr683
Ensembl Gene ENSMUSG00000044120
Gene Nameolfactory receptor 683
SynonymsGA_x6K02T2PBJ9-7773007-7772066, MOR40-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6354 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105140839-105147012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105143708 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 195 (T195I)
Ref Sequence ENSEMBL: ENSMUSP00000148110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061284] [ENSMUST00000209879]
Predicted Effect probably benign
Transcript: ENSMUST00000061284
AA Change: T201I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000060527
Gene: ENSMUSG00000044120
AA Change: T201I

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 8.5e-73 PFAM
Pfam:7TM_GPCR_Srsx 44 315 3.5e-8 PFAM
Pfam:7tm_1 50 300 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209879
AA Change: T195I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211388
Meta Mutation Damage Score 0.1505 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,794,216 K152E probably benign Het
Adamts20 C A 15: 94,347,810 C537F probably damaging Het
Apc A T 18: 34,312,528 T808S probably benign Het
Atad3a A G 4: 155,753,945 I205T possibly damaging Het
Casz1 G T 4: 148,952,542 G1754C unknown Het
Ccdc62 C T 5: 123,944,204 A232V probably damaging Het
Cdc27 C A 11: 104,534,748 D81Y probably damaging Het
Cep126 A G 9: 8,099,927 S869P probably damaging Het
Ciita A T 16: 10,523,746 K983N probably damaging Het
Clstn1 A C 4: 149,643,216 Q523P probably benign Het
Cpb2 T C 14: 75,257,705 probably null Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Csmd3 C T 15: 47,881,489 G1370D probably damaging Het
Cwf19l1 G T 19: 44,127,473 D172E probably benign Het
Cyp4a14 A G 4: 115,487,244 F475L probably damaging Het
Fam98c C T 7: 29,152,847 V298M probably damaging Het
Gcsh T C 8: 116,983,843 N127S probably benign Het
Gimap4 T C 6: 48,686,880 F10S possibly damaging Het
Gm4787 C T 12: 81,377,981 A468T probably damaging Het
Gm5111 G A 6: 48,590,334 probably benign Het
Gm7137 C A 10: 77,787,647 probably benign Het
Inpp1 A G 1: 52,797,065 S81P probably damaging Het
Iqce T C 5: 140,676,335 probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap13 C A 16: 88,751,243 C119F probably damaging Het
Lama2 G T 10: 27,212,068 D904E probably damaging Het
Lrrc37a T A 11: 103,464,387 I2535F unknown Het
Lrrc40 T A 3: 158,061,264 L452* probably null Het
Meis1 A T 11: 19,016,184 M63K possibly damaging Het
Mpo T A 11: 87,797,346 I277N possibly damaging Het
Mtmr11 T A 3: 96,168,676 F406I probably benign Het
Muc4 T C 16: 32,754,358 S1411P probably benign Het
Odf3 A G 7: 140,850,614 probably null Het
Olfr10 A T 11: 49,317,638 I31F probably damaging Het
Olfr1189 T A 2: 88,592,134 I110N probably damaging Het
Phf21a G A 2: 92,348,937 G298R probably damaging Het
Phldb2 T C 16: 45,825,114 Y368C probably damaging Het
Pik3cb G T 9: 99,073,643 T407K probably benign Het
Robo3 A T 9: 37,417,217 probably benign Het
Sgsm1 T G 5: 113,282,656 T288P probably damaging Het
Slc5a7 A G 17: 54,277,033 S410P probably damaging Het
Tmc6 A C 11: 117,774,236 C404G probably benign Het
Tnrc6c A T 11: 117,749,614 Q1410L possibly damaging Het
Trak1 A T 9: 121,451,726 T384S probably null Het
Txlna A T 4: 129,634,412 L244Q probably damaging Het
Ube3c T C 5: 29,663,583 F939L probably damaging Het
Vmn2r65 T A 7: 84,940,366 I781F probably benign Het
Vmn2r72 A G 7: 85,750,539 probably null Het
Vps36 T C 8: 22,205,755 S109P probably damaging Het
Wdr66 C T 5: 123,302,755 T1125I probably damaging Het
Wrn T C 8: 33,343,638 I82M possibly damaging Het
Zbtb49 T C 5: 38,203,559 R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 T1011A possibly damaging Het
Zfhx4 T C 3: 5,401,951 S2390P probably benign Het
Zfp619 C A 7: 39,534,819 T91K probably benign Het
Zfp644 A G 5: 106,636,753 S643P probably benign Het
Other mutations in Olfr683
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr683 APN 7 105143604 missense possibly damaging 0.48
IGL01984:Olfr683 APN 7 105143716 missense probably benign 0.00
IGL02456:Olfr683 APN 7 105143759 missense probably damaging 0.99
IGL03242:Olfr683 APN 7 105144266 missense probably benign 0.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R1282:Olfr683 UTSW 7 105143652 missense probably benign 0.01
R1485:Olfr683 UTSW 7 105143681 missense probably benign 0.00
R1653:Olfr683 UTSW 7 105143870 missense possibly damaging 0.80
R2130:Olfr683 UTSW 7 105143550 missense probably benign 0.03
R2355:Olfr683 UTSW 7 105143813 missense probably benign 0.11
R4491:Olfr683 UTSW 7 105143776 nonsense probably null
R4826:Olfr683 UTSW 7 105143968 missense probably damaging 0.99
R4980:Olfr683 UTSW 7 105144224 missense probably benign
R5934:Olfr683 UTSW 7 105143660 missense probably benign 0.12
R7371:Olfr683 UTSW 7 105143879 missense possibly damaging 0.82
R7463:Olfr683 UTSW 7 105143937 missense probably benign 0.00
R7753:Olfr683 UTSW 7 105143800 missense probably benign 0.07
R8208:Olfr683 UTSW 7 105143418 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTAGCACCAGCAAGACTGTG -3'
(R):5'- CCATCTGTAAGCCTCTACAGTACC -3'

Sequencing Primer
(F):5'- GCAAGACTGTGCTGAAGAAG -3'
(R):5'- TGTAAGCCTCTACAGTACCCATCC -3'
Posted On2018-04-27