Incidental Mutation 'R6356:Lcn11'
ID512996
Institutional Source Beutler Lab
Gene Symbol Lcn11
Ensembl Gene ENSMUSG00000069080
Gene Namelipocalin 11
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6356 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25777017-25780279 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 25778120 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 97 (G97*)
Ref Sequence ENSEMBL: ENSMUSP00000088822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091278] [ENSMUST00000211245]
Predicted Effect probably null
Transcript: ENSMUST00000091278
AA Change: G97*
SMART Domains Protein: ENSMUSP00000088822
Gene: ENSMUSG00000069080
AA Change: G97*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lipocalin 34 172 7.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211245
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,009 S152T probably benign Het
Aass A G 6: 23,093,902 V140A probably damaging Het
Add1 A G 5: 34,619,396 N32S probably null Het
Agap2 T C 10: 127,082,996 S414P unknown Het
Arhgef38 A G 3: 133,140,877 F376L probably benign Het
Cd22 A T 7: 30,877,702 I60N probably damaging Het
Cdh23 T A 10: 60,438,847 D488V probably damaging Het
Cox16 T G 12: 81,472,341 D148A probably damaging Het
Dclre1b G A 3: 103,808,155 T9I probably damaging Het
Dennd4c T C 4: 86,825,449 V1176A probably benign Het
Echdc1 A C 10: 29,344,526 probably null Het
Efnb3 G A 11: 69,556,140 A248V probably benign Het
Glud1 A G 14: 34,311,216 R107G probably benign Het
Gm11639 A G 11: 104,893,707 K2772E probably benign Het
Gtf2h4 A G 17: 35,669,755 S279P probably damaging Het
Hectd1 A G 12: 51,744,619 C2579R probably damaging Het
Igkv15-103 A G 6: 68,437,457 probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap5-2 T C 7: 142,175,382 probably benign Het
Lrrtm3 G A 10: 63,930,164 T548M probably benign Het
Map3k2 A T 18: 32,211,970 T283S probably damaging Het
Mast4 T C 13: 102,735,985 K2292E possibly damaging Het
Med23 G T 10: 24,888,413 C98F probably damaging Het
Morc1 T A 16: 48,437,289 F26Y probably damaging Het
Muc5ac T A 7: 141,812,679 M2160K probably benign Het
Myocd T C 11: 65,218,570 probably null Het
Nup160 T A 2: 90,711,935 probably null Het
Olfr812 T A 10: 129,842,608 S145C probably benign Het
Olfr993 T A 2: 85,414,687 Q64L probably damaging Het
Olr1 A T 6: 129,493,559 L215Q probably benign Het
Pik3c2a T C 7: 116,348,205 K1414R possibly damaging Het
Ppfibp2 T C 7: 107,681,769 V96A probably benign Het
Prim1 T A 10: 128,023,835 Y299N probably damaging Het
Rnf219 A G 14: 104,478,877 S687P probably damaging Het
Rsf1 T C 7: 97,661,934 S624P probably benign Het
Samd4b A T 7: 28,401,593 I687N probably damaging Het
Sbf2 A T 7: 110,372,623 F801L probably damaging Het
St6gal2 T C 17: 55,482,013 I16T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trim8 T G 19: 46,515,358 S450A probably benign Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Vmn2r24 A G 6: 123,806,409 S523G possibly damaging Het
Vmn2r52 T A 7: 10,168,999 M501L probably benign Het
Vmn2r68 C T 7: 85,233,840 V235M possibly damaging Het
Wdr66 G A 5: 123,254,666 probably benign Het
Zfhx3 G A 8: 108,946,619 V1434M probably damaging Het
Zmym5 A T 14: 56,794,165 N495K possibly damaging Het
Other mutations in Lcn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02904:Lcn11 APN 2 25779266 missense probably null 0.00
R0220:Lcn11 UTSW 2 25777831 missense probably benign 0.02
R0607:Lcn11 UTSW 2 25779293 missense probably benign 0.00
R1104:Lcn11 UTSW 2 25779103 unclassified probably benign
R2021:Lcn11 UTSW 2 25778085 missense probably benign 0.34
R2331:Lcn11 UTSW 2 25780176 missense possibly damaging 0.79
R4295:Lcn11 UTSW 2 25778099 missense possibly damaging 0.83
R6109:Lcn11 UTSW 2 25779296 missense possibly damaging 0.78
R6502:Lcn11 UTSW 2 25779091 missense probably benign 0.08
R7754:Lcn11 UTSW 2 25777818 missense probably benign 0.06
Z1176:Lcn11 UTSW 2 25777724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGAGAAGGCCTTGATGATC -3'
(R):5'- GACTGAGGGAGCACAGTTTG -3'

Sequencing Primer
(F):5'- AGAAGGCCTTGATGATCCTGTTG -3'
(R):5'- ACAGTTTGGAGCCACATCGTG -3'
Posted On2018-04-27