Incidental Mutation 'R6356:Dennd4c'
ID 513002
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene Name DENN/MADD domain containing 4C
Synonyms 1700065A05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6356 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 86748555-86850603 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86825449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1176 (V1176A)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
AlphaFold A6H8H2
Predicted Effect probably benign
Transcript: ENSMUST00000045512
AA Change: V1225A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: V1225A

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082026
AA Change: V1225A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: V1225A

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142837
AA Change: V1176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: V1176A

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,009 S152T probably benign Het
Aass A G 6: 23,093,902 V140A probably damaging Het
Add1 A G 5: 34,619,396 N32S probably null Het
Agap2 T C 10: 127,082,996 S414P unknown Het
Arhgef38 A G 3: 133,140,877 F376L probably benign Het
Cd22 A T 7: 30,877,702 I60N probably damaging Het
Cdh23 T A 10: 60,438,847 D488V probably damaging Het
Cox16 T G 12: 81,472,341 D148A probably damaging Het
Dclre1b G A 3: 103,808,155 T9I probably damaging Het
Echdc1 A C 10: 29,344,526 probably null Het
Efnb3 G A 11: 69,556,140 A248V probably benign Het
Glud1 A G 14: 34,311,216 R107G probably benign Het
Gm11639 A G 11: 104,893,707 K2772E probably benign Het
Gtf2h4 A G 17: 35,669,755 S279P probably damaging Het
Hectd1 A G 12: 51,744,619 C2579R probably damaging Het
Igkv15-103 A G 6: 68,437,457 probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap5-2 T C 7: 142,175,382 probably benign Het
Lcn11 G T 2: 25,778,120 G97* probably null Het
Lrrtm3 G A 10: 63,930,164 T548M probably benign Het
Map3k2 A T 18: 32,211,970 T283S probably damaging Het
Mast4 T C 13: 102,735,985 K2292E possibly damaging Het
Med23 G T 10: 24,888,413 C98F probably damaging Het
Morc1 T A 16: 48,437,289 F26Y probably damaging Het
Muc5ac T A 7: 141,812,679 M2160K probably benign Het
Myocd T C 11: 65,218,570 probably null Het
Nup160 T A 2: 90,711,935 probably null Het
Olfr812 T A 10: 129,842,608 S145C probably benign Het
Olfr993 T A 2: 85,414,687 Q64L probably damaging Het
Olr1 A T 6: 129,493,559 L215Q probably benign Het
Pik3c2a T C 7: 116,348,205 K1414R possibly damaging Het
Ppfibp2 T C 7: 107,681,769 V96A probably benign Het
Prim1 T A 10: 128,023,835 Y299N probably damaging Het
Rnf219 A G 14: 104,478,877 S687P probably damaging Het
Rsf1 T C 7: 97,661,934 S624P probably benign Het
Samd4b A T 7: 28,401,593 I687N probably damaging Het
Sbf2 A T 7: 110,372,623 F801L probably damaging Het
St6gal2 T C 17: 55,482,013 I16T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trim8 T G 19: 46,515,358 S450A probably benign Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Vmn2r24 A G 6: 123,806,409 S523G possibly damaging Het
Vmn2r52 T A 7: 10,168,999 M501L probably benign Het
Vmn2r68 C T 7: 85,233,840 V235M possibly damaging Het
Wdr66 G A 5: 123,254,666 probably benign Het
Zfhx3 G A 8: 108,946,619 V1434M probably damaging Het
Zmym5 A T 14: 56,794,165 N495K possibly damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
R8307:Dennd4c UTSW 4 86825872 missense probably benign 0.12
R8494:Dennd4c UTSW 4 86841075 missense probably damaging 1.00
R8531:Dennd4c UTSW 4 86826082 critical splice donor site probably null
R9014:Dennd4c UTSW 4 86821465 missense probably benign 0.07
R9014:Dennd4c UTSW 4 86836429 missense probably benign 0.00
R9017:Dennd4c UTSW 4 86825112 missense probably benign 0.33
R9142:Dennd4c UTSW 4 86837400 missense probably benign 0.32
R9224:Dennd4c UTSW 4 86819933 nonsense probably null
R9570:Dennd4c UTSW 4 86828971 missense possibly damaging 0.71
R9644:Dennd4c UTSW 4 86795126 missense probably damaging 0.99
R9649:Dennd4c UTSW 4 86824923 missense probably benign 0.00
R9658:Dennd4c UTSW 4 86836388 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACAGATCATCTCCTGTGC -3'
(R):5'- TCTCCATGCAATTCCATACTACAAG -3'

Sequencing Primer
(F):5'- CAGATCATCTCCTGTGCTAGAGATG -3'
(R):5'- CTACAAGATTTACTGCCTAGTGGG -3'
Posted On 2018-04-27