Incidental Mutation 'R6356:Sbf2'
ID 513015
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene Name SET binding factor 2
Synonyms B430219L04Rik, 4833411B01Rik, SBF2, Mtmr13, mMTMH1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R6356 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109907220-110214129 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109971830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 801 (F801L)
Ref Sequence ENSEMBL: ENSMUSP00000132072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
AlphaFold E9PXF8
Predicted Effect probably damaging
Transcript: ENSMUST00000033058
AA Change: F801L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: F801L

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: F801L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: F801L

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165449
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: F755L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: F755L

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171378
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,161,292 (GRCm39) S152T probably benign Het
Aass A G 6: 23,093,901 (GRCm39) V140A probably damaging Het
Add1 A G 5: 34,776,740 (GRCm39) N32S probably null Het
Agap2 T C 10: 126,918,865 (GRCm39) S414P unknown Het
Arhgef38 A G 3: 132,846,638 (GRCm39) F376L probably benign Het
Cd22 A T 7: 30,577,127 (GRCm39) I60N probably damaging Het
Cdh23 T A 10: 60,274,626 (GRCm39) D488V probably damaging Het
Cfap251 G A 5: 123,392,729 (GRCm39) probably benign Het
Cox16 T G 12: 81,519,115 (GRCm39) D148A probably damaging Het
Dclre1b G A 3: 103,715,471 (GRCm39) T9I probably damaging Het
Dennd4c T C 4: 86,743,686 (GRCm39) V1176A probably benign Het
Echdc1 A C 10: 29,220,522 (GRCm39) probably null Het
Efcab3 A G 11: 104,784,533 (GRCm39) K2772E probably benign Het
Efnb3 G A 11: 69,446,966 (GRCm39) A248V probably benign Het
Glud1 A G 14: 34,033,173 (GRCm39) R107G probably benign Het
Gtf2h4 A G 17: 35,980,647 (GRCm39) S279P probably damaging Het
Hectd1 A G 12: 51,791,402 (GRCm39) C2579R probably damaging Het
Igkv15-103 A G 6: 68,414,441 (GRCm39) probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,479,217 (GRCm39) probably benign Het
Krtap5-2 T C 7: 141,729,119 (GRCm39) probably benign Het
Lcn11 G T 2: 25,668,132 (GRCm39) G97* probably null Het
Lrrtm3 G A 10: 63,765,943 (GRCm39) T548M probably benign Het
Map3k2 A T 18: 32,345,023 (GRCm39) T283S probably damaging Het
Mast4 T C 13: 102,872,493 (GRCm39) K2292E possibly damaging Het
Med23 G T 10: 24,764,311 (GRCm39) C98F probably damaging Het
Morc1 T A 16: 48,257,652 (GRCm39) F26Y probably damaging Het
Muc5ac T A 7: 141,366,416 (GRCm39) M2160K probably benign Het
Myocd T C 11: 65,109,396 (GRCm39) probably null Het
Nup160 T A 2: 90,542,279 (GRCm39) probably null Het
Obi1 A G 14: 104,716,313 (GRCm39) S687P probably damaging Het
Olr1 A T 6: 129,470,522 (GRCm39) L215Q probably benign Het
Or5ak23 T A 2: 85,245,031 (GRCm39) Q64L probably damaging Het
Or6c216 T A 10: 129,678,477 (GRCm39) S145C probably benign Het
Pik3c2a T C 7: 115,947,440 (GRCm39) K1414R possibly damaging Het
Ppfibp2 T C 7: 107,280,976 (GRCm39) V96A probably benign Het
Prim1 T A 10: 127,859,704 (GRCm39) Y299N probably damaging Het
Rsf1 T C 7: 97,311,141 (GRCm39) S624P probably benign Het
Samd4b A T 7: 28,101,018 (GRCm39) I687N probably damaging Het
St6gal2 T C 17: 55,789,014 (GRCm39) I16T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,464,897 (GRCm39) probably null Het
Trim8 T G 19: 46,503,797 (GRCm39) S450A probably benign Het
Trp53bp2 A G 1: 182,276,562 (GRCm39) T848A probably benign Het
Vmn2r24 A G 6: 123,783,368 (GRCm39) S523G possibly damaging Het
Vmn2r52 T A 7: 9,902,926 (GRCm39) M501L probably benign Het
Vmn2r68 C T 7: 84,883,048 (GRCm39) V235M possibly damaging Het
Zfhx3 G A 8: 109,673,251 (GRCm39) V1434M probably damaging Het
Zmym5 A T 14: 57,031,622 (GRCm39) N495K possibly damaging Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 109,975,039 (GRCm39) splice site probably benign
IGL01089:Sbf2 APN 7 109,948,169 (GRCm39) missense probably damaging 1.00
IGL01144:Sbf2 APN 7 109,929,110 (GRCm39) missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110,046,327 (GRCm39) missense probably damaging 1.00
IGL01950:Sbf2 APN 7 109,965,032 (GRCm39) missense probably benign 0.00
IGL02027:Sbf2 APN 7 110,060,348 (GRCm39) missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110,159,502 (GRCm39) missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110,062,163 (GRCm39) missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110,062,139 (GRCm39) missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 109,911,959 (GRCm39) missense probably benign
R0084:Sbf2 UTSW 7 110,041,573 (GRCm39) missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 109,920,013 (GRCm39) splice site probably benign
R0121:Sbf2 UTSW 7 110,088,426 (GRCm39) critical splice donor site probably null
R0464:Sbf2 UTSW 7 110,063,783 (GRCm39) splice site probably benign
R0505:Sbf2 UTSW 7 109,998,550 (GRCm39) missense probably damaging 1.00
R0531:Sbf2 UTSW 7 109,966,530 (GRCm39) splice site probably benign
R0554:Sbf2 UTSW 7 110,027,494 (GRCm39) missense probably damaging 1.00
R0617:Sbf2 UTSW 7 109,929,890 (GRCm39) frame shift probably null
R0619:Sbf2 UTSW 7 109,909,469 (GRCm39) missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 109,940,562 (GRCm39) missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 109,970,859 (GRCm39) missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 109,966,379 (GRCm39) splice site probably benign
R1167:Sbf2 UTSW 7 109,963,756 (GRCm39) missense probably damaging 1.00
R1169:Sbf2 UTSW 7 109,909,391 (GRCm39) missense probably benign 0.04
R1424:Sbf2 UTSW 7 109,914,233 (GRCm39) missense probably damaging 1.00
R1536:Sbf2 UTSW 7 109,977,250 (GRCm39) missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110,027,553 (GRCm39) missense probably damaging 1.00
R1601:Sbf2 UTSW 7 109,939,283 (GRCm39) critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 109,911,965 (GRCm39) missense probably benign
R1771:Sbf2 UTSW 7 110,060,353 (GRCm39) nonsense probably null
R1989:Sbf2 UTSW 7 109,948,130 (GRCm39) missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110,060,419 (GRCm39) missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110,159,502 (GRCm39) missense probably damaging 1.00
R2444:Sbf2 UTSW 7 109,929,905 (GRCm39) missense probably benign 0.31
R3765:Sbf2 UTSW 7 109,974,788 (GRCm39) missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110,088,487 (GRCm39) makesense probably null
R3895:Sbf2 UTSW 7 110,046,298 (GRCm39) missense probably damaging 0.99
R3978:Sbf2 UTSW 7 109,929,092 (GRCm39) missense probably benign 0.00
R4056:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110,027,449 (GRCm39) missense probably damaging 1.00
R4569:Sbf2 UTSW 7 109,948,060 (GRCm39) critical splice donor site probably null
R4670:Sbf2 UTSW 7 109,934,606 (GRCm39) missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110,020,124 (GRCm39) missense probably damaging 1.00
R4792:Sbf2 UTSW 7 109,950,817 (GRCm39) missense probably damaging 0.98
R4811:Sbf2 UTSW 7 109,971,742 (GRCm39) missense probably damaging 1.00
R4822:Sbf2 UTSW 7 109,977,146 (GRCm39) intron probably benign
R5110:Sbf2 UTSW 7 109,963,864 (GRCm39) missense probably benign 0.10
R5143:Sbf2 UTSW 7 110,021,747 (GRCm39) nonsense probably null
R5443:Sbf2 UTSW 7 109,977,135 (GRCm39) intron probably benign
R5457:Sbf2 UTSW 7 109,912,037 (GRCm39) missense probably benign
R5641:Sbf2 UTSW 7 110,038,108 (GRCm39) missense probably damaging 1.00
R5915:Sbf2 UTSW 7 109,977,303 (GRCm39) nonsense probably null
R5948:Sbf2 UTSW 7 110,088,492 (GRCm39) missense probably damaging 1.00
R5977:Sbf2 UTSW 7 109,977,193 (GRCm39) missense probably benign 0.00
R6052:Sbf2 UTSW 7 110,040,741 (GRCm39) missense probably damaging 1.00
R6142:Sbf2 UTSW 7 109,948,182 (GRCm39) missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110,040,759 (GRCm39) missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110,062,070 (GRCm39) missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110,040,182 (GRCm39) missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110,159,505 (GRCm39) missense probably benign 0.04
R6986:Sbf2 UTSW 7 109,929,822 (GRCm39) missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110,046,268 (GRCm39) missense probably benign 0.01
R7358:Sbf2 UTSW 7 109,998,555 (GRCm39) missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 109,913,271 (GRCm39) missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 109,965,028 (GRCm39) missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110,038,055 (GRCm39) missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 109,974,984 (GRCm39) nonsense probably null
R7431:Sbf2 UTSW 7 109,950,957 (GRCm39) missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110,213,923 (GRCm39) nonsense probably null
R7556:Sbf2 UTSW 7 109,913,260 (GRCm39) missense probably benign 0.20
R7604:Sbf2 UTSW 7 109,977,274 (GRCm39) missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 109,929,920 (GRCm39) critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110,040,633 (GRCm39) missense probably benign 0.01
R7812:Sbf2 UTSW 7 110,049,170 (GRCm39) missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 109,971,717 (GRCm39) missense probably damaging 1.00
R8026:Sbf2 UTSW 7 109,934,594 (GRCm39) missense probably damaging 1.00
R8048:Sbf2 UTSW 7 109,914,289 (GRCm39) missense probably benign 0.21
R8305:Sbf2 UTSW 7 109,970,825 (GRCm39) missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110,040,669 (GRCm39) missense probably benign
R8773:Sbf2 UTSW 7 109,948,202 (GRCm39) missense probably benign
R8786:Sbf2 UTSW 7 110,063,793 (GRCm39) critical splice donor site probably null
R8812:Sbf2 UTSW 7 109,929,069 (GRCm39) missense probably damaging 1.00
R8876:Sbf2 UTSW 7 110,049,146 (GRCm39) missense probably damaging 0.99
R8932:Sbf2 UTSW 7 110,040,155 (GRCm39) critical splice donor site probably null
R8954:Sbf2 UTSW 7 110,038,118 (GRCm39) nonsense probably null
R8991:Sbf2 UTSW 7 109,911,896 (GRCm39) missense probably benign 0.20
R9119:Sbf2 UTSW 7 109,911,292 (GRCm39) missense possibly damaging 0.93
R9310:Sbf2 UTSW 7 109,914,292 (GRCm39) missense possibly damaging 0.58
R9344:Sbf2 UTSW 7 109,940,535 (GRCm39) missense probably benign 0.10
R9346:Sbf2 UTSW 7 109,919,946 (GRCm39) missense probably benign 0.05
R9404:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9406:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9408:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9472:Sbf2 UTSW 7 109,970,798 (GRCm39) missense possibly damaging 0.88
R9554:Sbf2 UTSW 7 110,040,671 (GRCm39) missense probably damaging 1.00
R9562:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9624:Sbf2 UTSW 7 109,963,857 (GRCm39) missense probably damaging 1.00
R9652:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9653:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9709:Sbf2 UTSW 7 110,027,514 (GRCm39) missense probably damaging 0.99
RF005:Sbf2 UTSW 7 109,916,215 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTGCAACACTCTGACC -3'
(R):5'- TAACATTCCGTGCCTGACAC -3'

Sequencing Primer
(F):5'- TGCAACACTCTGACCCGTTAG -3'
(R):5'- GCCTGGCCATGATTTCTT -3'
Posted On 2018-04-27